The fragments base pair sequences and other supplementary materials The fragments base pair sequences and other supplementary materials for paper:


Ultrasonic Cleavage of Nicked DNA

I.A. Il'icheva1, D.Yu. Nechipurenko2, S.L. Grokhovsky1,*

1) Engelhardt Institute of Molecular Biology RAS, Vavilov str., 32 Moscow 119991, Russia

2) Dep. of Physics, Moscow State University, Moscow 119992, Russia

*) Phone: 499135 97 18 Fax: 499135 14 05 E-mail: grok@imb.ac.ru;




Name of gel and number of scan = No52-7 def.101 - 12% gel - 10min nickase
Name of sequence = pUC9G - Fragment-258-DdeI
Number of lanes =  7 
Lane for analysis =  5 
Number of analysing nucleotide =  114 
First analysing nucleotide =  197 
3'-nucleotide before nik =  285 
5'-TTCTGACGAGTTCTAACTTGGCTTCATTGCACCGTTTGACAGGTAACTTTGTAATCTCGCTAAGTTGAGAATCGGTGATTCTGTCCATTGGTTTATTCCACCCATAGGTTTTACGCAGAATGGCAAGCAGCACTTTAAACTGTCGCTTGGTCAGATCTGCGCCCGAATAAGCCTCAAGCAGCATATTTGATAGTCTGGCGTAACCATCATCGAGATCTGCCACATTACGCTCCTGTCCGGCAAAGTTACCTCTGCCGAAGTTGAGTATTTTTGCTGTATTTGTCATAATGACTCCTGTTGATAGATCCAGTAATGACCTCA0
Length of fragment =  321   P(K)=P(K)/100

 197 G 6409 
 198 G 728 
 199 C 5610 
 200 G 1716 
 201 T 2366 
 202 A 1768 
 203 A 1436 
 204 C 2068 
 205 C 1897 
 206 A 1260 
 207 T 1264 
 208 C 1764 
 209 A 1146 
 210 T 1359 
 211 C 2977 
 212 G 1481 
 213 A 1137 
 214 G 1659 
 215 A 1867 
 216 T 885 
 217 C 1652 
 218 T 1312 
 219 G 1246 
 220 C 1354 
 221 C 1203 
 222 A 1060 
 223 C 1476 
 224 A 1166 
 225 T 1213 
 226 T 1147 
 227 A 1139 
 228 C 2307 
 229 G 1202 
 230 C 1620 
 231 T 1170 
 232 C 1362 
 233 C 1757 
 234 T 1347 
 235 G 1568 
 236 T 1318 
 237 C 1408 
 238 C 1701 
 239 G 1216 
 240 G 1384 
 241 C 1448 
 242 A 1275 
 243 A 1206 
 244 A 1042 
 245 G 1137 
 246 T 1056 
 247 T 1203 
 248 A 1190 
 249 C 1138 
 250 C 1183 
 251 T 1093 
 252 C 1346 
 253 T 1178 
 254 G 1266 
 255 C 1316 
 256 C 1703 
 257 G 1295 
 258 A 1169 
 259 A 1266 
 260 G 1457 
 261 T 1440 
 262 T 1425 
 263 G 1461 
 264 A 1323 
 265 G 1689 
 266 T 1895 
 267 A 1815 
 268 T 2155 
 269 T 2269 
 270 T 2558 
 271 T 2823 
 272 T 2796 
 273 G 3942 
 274 C 4803 
 275 T 4651 
 276 G 5052 
 277 T 5763 
 278 A 5936 
 279 T 7784 
 280 T 8876 
 281 T 9164 
 282 G 10317 
 283 T 11709 
 284 C 12777 
 285 A 6187 
 286 T 7888 
 287 A 4759 
 288 A 2969 
 289 T 2185 
 290 G 1273 
 291 A 818 
 292 C 800 
 293 T 611 
 294 C 546 
 295 C 518 
 296 T 418 
 297 G 378 
 298 T 307 
 299 T 328 
 300 G 300 
 301 A 285 
 302 T 277 
 303 A 274 
 304 G 288 
 305 A 284 
 306 T 260 
 307 C 271 
 308 C 259 
 309 A 256 
 310 G 216 

MAX = 12777   MIN = 216 

Length from 5'-end
 197 G        ################################################
 198 G        ####
 199 C        ##########################################
 200 G        ###########
 201 T        ################
 202 A        ############
 203 A        #########
 204 C        ##############
 205 C        #############
 206 A        ########
 207 T        ########
 208 C        ############
 209 A        #######
 210 T        ########
 211 C        #####################
 212 G        #########
 213 A        #######
 214 G        ###########
 215 A        ############
 216 T        #####
 217 C        ###########
 218 T        ########
 219 G        ########
 220 C        ########
 221 C        #######
 222 A        ######
 223 C        #########
 224 A        #######
 225 T        #######
 226 T        #######
 227 A        #######
 228 C        ################
 229 G        #######
 230 C        ##########
 231 T        #######
 232 C        ########
 233 C        ############
 234 T        ########
 235 G        ##########
 236 T        ########
 237 C        #########
 238 C        ###########
 239 G        #######
 240 G        #########
 241 C        #########
 242 A        ########
 243 A        #######
 244 A        ######
 245 G        #######
 246 T        ######
 247 T        #######
 248 A        #######
 249 C        #######
 250 C        #######
 251 T        ######
 252 C        ########
 253 T        #######
 254 G        ########
 255 C        ########
 256 C        ###########
 257 G        ########
 258 A        #######
 259 A        ########
 260 G        #########
 261 T        #########
 262 T        #########
 263 G        #########
 264 A        ########
 265 G        ###########
 266 T        #############
 267 A        ############
 268 T        ###############
 269 T        ################
 270 T        ##################
 271 T        ####################
 272 T        ####################
 273 G        #############################
 274 C        ###################################
 275 T        ##################################
 276 G        #####################################
 277 T        ###########################################
 278 A        ############################################
 279 T        ###########################################################
 280 T        ###################################################################
 281 T        ######################################################################
 282 G        ###############################################################################
 283 T        #########################################################################################
 284 C        ##################################################################################################
 285 A        ##############################################
 286 T        ############################################################
 287 A        ###################################
 288 A        #####################
 289 T        ###############
 290 G        ########
 291 A        ####
 292 C        ####
 293 T        ###
 294 C        ##
 295 C        ##
 296 T        #
 297 G        #
 298 T        
 299 T        
 300 G        
 301 A        
 302 T        
 303 A        
 304 G        
 305 A        
 306 T        
 307 C        
 308 C        
 309 A        
 310 G        


Length from 3'-end
 125 G        ################################################
 124 G        ####
 123 C        ##########################################
 122 G        ###########
 121 T        ################
 120 A        ############
 119 A        #########
 118 C        ##############
 117 C        #############
 116 A        ########
 115 T        ########
 114 C        ############
 113 A        #######
 112 T        ########
 111 C        #####################
 110 G        #########
 109 A        #######
 108 G        ###########
 107 A        ############
 106 T        #####
 105 C        ###########
 104 T        ########
 103 G        ########
 102 C        ########
 101 C        #######
 100 A        ######
 99 C         #########
 98 A         #######
 97 T         #######
 96 T         #######
 95 A         #######
 94 C         ################
 93 G         #######
 92 C         ##########
 91 T         #######
 90 C         ########
 89 C         ############
 88 T         ########
 87 G         ##########
 86 T         ########
 85 C         #########
 84 C         ###########
 83 G         #######
 82 G         #########
 81 C         #########
 80 A         ########
 79 A         #######
 78 A         ######
 77 G         #######
 76 T         ######
 75 T         #######
 74 A         #######
 73 C         #######
 72 C         #######
 71 T         ######
 70 C         ########
 69 T         #######
 68 G         ########
 67 C         ########
 66 C         ###########
 65 G         ########
 64 A         #######
 63 A         ########
 62 G         #########
 61 T         #########
 60 T         #########
 59 G         #########
 58 A         ########
 57 G         ###########
 56 T         #############
 55 A         ############
 54 T         ###############
 53 T         ################
 52 T         ##################
 51 T         ####################
 50 T         ####################
 49 G         #############################
 48 C         ###################################
 47 T         ##################################
 46 G         #####################################
 45 T         ###########################################
 44 A         ############################################
 43 T         ###########################################################
 42 T         ###################################################################
 41 T         ######################################################################
 40 G         ###############################################################################
 39 T         #########################################################################################
 38 C         ##################################################################################################
 37 A         ##############################################
 36 T         ############################################################
 35 A         ###################################
 34 A         #####################
 33 T         ###############
 32 G         ########
 31 A         ####
 30 C         ####
 29 T         ###
 28 C         ##
 27 C         ##
 26 T         #
 25 G         #
 24 T         
 23 T         
 22 G         
 21 A         
 20 T         
 19 A         
 18 G         
 17 A         
 16 T         
 15 C         
 14 C         
 13 A         
 12 G         


Length from nick
-89 G         ################################################
-88 G         ####
-87 C         ##########################################
-86 G         ###########
-85 T         ################
-84 A         ############
-83 A         #########
-82 C         ##############
-81 C         #############
-80 A         ########
-79 T         ########
-78 C         ############
-77 A         #######
-76 T         ########
-75 C         #####################
-74 G         #########
-73 A         #######
-72 G         ###########
-71 A         ############
-70 T         #####
-69 C         ###########
-68 T         ########
-67 G         ########
-66 C         ########
-65 C         #######
-64 A         ######
-63 C         #########
-62 A         #######
-61 T         #######
-60 T         #######
-59 A         #######
-58 C         ################
-57 G         #######
-56 C         ##########
-55 T         #######
-54 C         ########
-53 C         ############
-52 T         ########
-51 G         ##########
-50 T         ########
-49 C         #########
-48 C         ###########
-47 G         #######
-46 G         #########
-45 C         #########
-44 A         ########
-43 A         #######
-42 A         ######
-41 G         #######
-40 T         ######
-39 T         #######
-38 A         #######
-37 C         #######
-36 C         #######
-35 T         ######
-34 C         ########
-33 T         #######
-32 G         ########
-31 C         ########
-30 C         ###########
-29 G         ########
-28 A         #######
-27 A         ########
-26 G         #########
-25 T         #########
-24 T         #########
-23 G         #########
-22 A         ########
-21 G         ###########
-20 T         #############
-19 A         ############
-18 T         ###############
-17 T         ################
-16 T         ##################
-15 T         ####################
-14 T         ####################
-13 G         #############################
-12 C         ###################################
-11 T         ##################################
-10 G         #####################################
-9 T          ###########################################
-8 A          ############################################
-7 T          ###########################################################
-6 T          ###################################################################
-5 T          ######################################################################
-4 G          ###############################################################################
-3 T          #########################################################################################
-2 C          ##################################################################################################
-1 A          ##############################################
 1 T          ############################################################
 2 A          ###################################
 3 A          #####################
 4 T          ###############
 5 G          ########
 6 A          ####
 7 C          ####
 8 T          ###
 9 C          ##
 10 C         ##
 11 T         #
 12 G         #
 13 T         
 14 T         
 15 G         
 16 A         
 17 T         
 18 A         
 19 G         
 20 A         
 21 T         
 22 C         
 23 C         
 24 A         
 25 G         


Name of gel and number of scan = No52-7 def.101 - 12% gel - 1h nickase
Name of sequence = pUC9G - Fragment-258-DdeI
Number of lanes =  7 
Lane for analysis =  6 
Number of analysing nucleotide =  114 
First analysing nucleotide =  197 
3'-nucleotide before nik =  285 
5'-TTCTGACGAGTTCTAACTTGGCTTCATTGCACCGTTTGACAGGTAACTTTGTAATCTCGCTAAGTTGAGAATCGGTGATTCTGTCCATTGGTTTATTCCACCCATAGGTTTTACGCAGAATGGCAAGCAGCACTTTAAACTGTCGCTTGGTCAGATCTGCGCCCGAATAAGCCTCAAGCAGCATATTTGATAGTCTGGCGTAACCATCATCGAGATCTGCCACATTACGCTCCTGTCCGGCAAAGTTACCTCTGCCGAAGTTGAGTATTTTTGCTGTATTTGTCATAATGACTCCTGTTGATAGATCCAGTAATGACCTCA0
Length of fragment =  321   P(K)=P(K)/100

 197 G 9877 
 198 G 1352 
 199 C 8089 
 200 G 2224 
 201 T 4016 
 202 A 2257 
 203 A 2136 
 204 C 3064 
 205 C 2888 
 206 A 1768 
 207 T 2253 
 208 C 2782 
 209 A 1566 
 210 T 2199 
 211 C 4684 
 212 G 2945 
 213 A 2598 
 214 G 1782 
 215 A 2588 
 216 T 2527 
 217 C 982 
 218 T 1658 
 219 G 1661 
 220 C 2061 
 221 C 1806 
 222 A 1418 
 223 C 2070 
 224 A 1591 
 225 T 1746 
 226 T 1630 
 227 A 1623 
 228 C 3496 
 229 G 1649 
 230 C 2318 
 231 T 1556 
 232 C 1899 
 233 C 2488 
 234 T 1843 
 235 G 2019 
 236 T 1663 
 237 C 1880 
 238 C 2308 
 239 G 1474 
 240 G 1662 
 241 C 1789 
 242 A 1536 
 243 A 1423 
 244 A 1212 
 245 G 1318 
 246 T 1253 
 247 T 1377 
 248 A 1311 
 249 C 1272 
 250 C 1331 
 251 T 1207 
 252 C 1529 
 253 T 1323 
 254 G 1395 
 255 C 1417 
 256 C 1894 
 257 G 1329 
 258 A 1286 
 259 A 1384 
 260 G 1432 
 261 T 1406 
 262 T 1388 
 263 G 1445 
 264 A 1314 
 265 G 1644 
 266 T 1849 
 267 A 1769 
 268 T 2144 
 269 T 2247 
 270 T 2570 
 271 T 2827 
 272 T 2873 
 273 G 4192 
 274 C 5068 
 275 T 4828 
 276 G 5483 
 277 T 6173 
 278 A 6724 
 279 T 8964 
 280 T 10480 
 281 T 11091 
 282 G 13389 
 283 T 15205 
 284 C 17344 
 285 A 8006 
 286 T 10562 
 287 A 6464 
 288 A 3850 
 289 T 2719 
 290 G 1623 
 291 A 1006 
 292 C 957 
 293 T 701 
 294 C 612 
 295 C 535 
 296 T 498 
 297 G 414 
 298 T 342 
 299 T 331 
 300 G 338 
 301 A 309 
 302 T 295 
 303 A 257 
 304 G 269 
 305 A 255 
 306 T 249 
 307 C 224 
 308 C 228 
 309 A 226 
 310 G 186 

MAX = 17344   MIN = 186 

Length from 5'-end
 197 G        #######################################################
 198 G        ######
 199 C        #############################################
 200 G        ###########
 201 T        ######################
 202 A        ###########
 203 A        ###########
 204 C        ################
 205 C        ###############
 206 A        #########
 207 T        ###########
 208 C        ##############
 209 A        #######
 210 T        ###########
 211 C        #########################
 212 G        ###############
 213 A        #############
 214 G        #########
 215 A        #############
 216 T        #############
 217 C        ####
 218 T        ########
 219 G        ########
 220 C        ##########
 221 C        #########
 222 A        #######
 223 C        ##########
 224 A        ########
 225 T        ########
 226 T        ########
 227 A        ########
 228 C        ###################
 229 G        ########
 230 C        ############
 231 T        #######
 232 C        #########
 233 C        #############
 234 T        #########
 235 G        ##########
 236 T        ########
 237 C        #########
 238 C        ############
 239 G        #######
 240 G        ########
 241 C        #########
 242 A        #######
 243 A        #######
 244 A        #####
 245 G        ######
 246 T        ######
 247 T        ######
 248 A        ######
 249 C        ######
 250 C        ######
 251 T        #####
 252 C        #######
 253 T        ######
 254 G        ######
 255 C        #######
 256 C        #########
 257 G        ######
 258 A        ######
 259 A        ######
 260 G        #######
 261 T        #######
 262 T        ######
 263 G        #######
 264 A        ######
 265 G        ########
 266 T        #########
 267 A        #########
 268 T        ###########
 269 T        ###########
 270 T        #############
 271 T        ###############
 272 T        ###############
 273 G        #######################
 274 C        ############################
 275 T        ##########################
 276 G        ##############################
 277 T        ##################################
 278 A        #####################################
 279 T        ##################################################
 280 T        ###########################################################
 281 T        ##############################################################
 282 G        ############################################################################
 283 T        ######################################################################################
 284 C        ##################################################################################################
 285 A        #############################################
 286 T        ###########################################################
 287 A        ####################################
 288 A        #####################
 289 T        ##############
 290 G        ########
 291 A        ####
 292 C        ####
 293 T        ##
 294 C        ##
 295 C        ##
 296 T        #
 297 G        #
 298 T        
 299 T        
 300 G        
 301 A        
 302 T        
 303 A        
 304 G        
 305 A        
 306 T        
 307 C        
 308 C        
 309 A        
 310 G        


Length from 3'-end
 125 G        #######################################################
 124 G        ######
 123 C        #############################################
 122 G        ###########
 121 T        ######################
 120 A        ###########
 119 A        ###########
 118 C        ################
 117 C        ###############
 116 A        #########
 115 T        ###########
 114 C        ##############
 113 A        #######
 112 T        ###########
 111 C        #########################
 110 G        ###############
 109 A        #############
 108 G        #########
 107 A        #############
 106 T        #############
 105 C        ####
 104 T        ########
 103 G        ########
 102 C        ##########
 101 C        #########
 100 A        #######
 99 C         ##########
 98 A         ########
 97 T         ########
 96 T         ########
 95 A         ########
 94 C         ###################
 93 G         ########
 92 C         ############
 91 T         #######
 90 C         #########
 89 C         #############
 88 T         #########
 87 G         ##########
 86 T         ########
 85 C         #########
 84 C         ############
 83 G         #######
 82 G         ########
 81 C         #########
 80 A         #######
 79 A         #######
 78 A         #####
 77 G         ######
 76 T         ######
 75 T         ######
 74 A         ######
 73 C         ######
 72 C         ######
 71 T         #####
 70 C         #######
 69 T         ######
 68 G         ######
 67 C         #######
 66 C         #########
 65 G         ######
 64 A         ######
 63 A         ######
 62 G         #######
 61 T         #######
 60 T         ######
 59 G         #######
 58 A         ######
 57 G         ########
 56 T         #########
 55 A         #########
 54 T         ###########
 53 T         ###########
 52 T         #############
 51 T         ###############
 50 T         ###############
 49 G         #######################
 48 C         ############################
 47 T         ##########################
 46 G         ##############################
 45 T         ##################################
 44 A         #####################################
 43 T         ##################################################
 42 T         ###########################################################
 41 T         ##############################################################
 40 G         ############################################################################
 39 T         ######################################################################################
 38 C         ##################################################################################################
 37 A         #############################################
 36 T         ###########################################################
 35 A         ####################################
 34 A         #####################
 33 T         ##############
 32 G         ########
 31 A         ####
 30 C         ####
 29 T         ##
 28 C         ##
 27 C         ##
 26 T         #
 25 G         #
 24 T         
 23 T         
 22 G         
 21 A         
 20 T         
 19 A         
 18 G         
 17 A         
 16 T         
 15 C         
 14 C         
 13 A         
 12 G         


Length from nick
-89 G         #######################################################
-88 G         ######
-87 C         #############################################
-86 G         ###########
-85 T         ######################
-84 A         ###########
-83 A         ###########
-82 C         ################
-81 C         ###############
-80 A         #########
-79 T         ###########
-78 C         ##############
-77 A         #######
-76 T         ###########
-75 C         #########################
-74 G         ###############
-73 A         #############
-72 G         #########
-71 A         #############
-70 T         #############
-69 C         ####
-68 T         ########
-67 G         ########
-66 C         ##########
-65 C         #########
-64 A         #######
-63 C         ##########
-62 A         ########
-61 T         ########
-60 T         ########
-59 A         ########
-58 C         ###################
-57 G         ########
-56 C         ############
-55 T         #######
-54 C         #########
-53 C         #############
-52 T         #########
-51 G         ##########
-50 T         ########
-49 C         #########
-48 C         ############
-47 G         #######
-46 G         ########
-45 C         #########
-44 A         #######
-43 A         #######
-42 A         #####
-41 G         ######
-40 T         ######
-39 T         ######
-38 A         ######
-37 C         ######
-36 C         ######
-35 T         #####
-34 C         #######
-33 T         ######
-32 G         ######
-31 C         #######
-30 C         #########
-29 G         ######
-28 A         ######
-27 A         ######
-26 G         #######
-25 T         #######
-24 T         ######
-23 G         #######
-22 A         ######
-21 G         ########
-20 T         #########
-19 A         #########
-18 T         ###########
-17 T         ###########
-16 T         #############
-15 T         ###############
-14 T         ###############
-13 G         #######################
-12 C         ############################
-11 T         ##########################
-10 G         ##############################
-9 T          ##################################
-8 A          #####################################
-7 T          ##################################################
-6 T          ###########################################################
-5 T          ##############################################################
-4 G          ############################################################################
-3 T          ######################################################################################
-2 C          ##################################################################################################
-1 A          #############################################
 1 T          ###########################################################
 2 A          ####################################
 3 A          #####################
 4 T          ##############
 5 G          ########
 6 A          ####
 7 C          ####
 8 T          ##
 9 C          ##
 10 C         ##
 11 T         #
 12 G         #
 13 T         
 14 T         
 15 G         
 16 A         
 17 T         
 18 A         
 19 G         
 20 A         
 21 T         
 22 C         
 23 C         
 24 A         
 25 G         


Name of gel and number of scan = No52a def.129 - 6% gel - 10 min nickase
Name of sequence = pUC9G - Fragment-258-DdeI
Number of lanes =  5 
Lane for analysis =  3 
Number of analysing nucleotide =  186 
First analysing nucleotide =  125 
3'-nucleotide before nik =  285 
5'-TTCTGACGAGTTCTAACTTGGCTTCATTGCACCGTTTGACAGGTAACTTTGTAATCTCGCTAAGTTGAGAATCGGTGATTCTGTCCATTGGTTTATTCCACCCATAGGTTTTACGCAGAATGGCAAGCAGCACTTTAAACTGTCGCTTGGTCAGATCTGCGCCCGAATAAGCCTCAAGCAGCATATTTGATAGTCTGGCGTAACCATCATCGAGATCTGCCACATTACGCTCCTGTCCGGCAAAGTTACCTCTGCCGAAGTTGAGTATTTTTGCTGTATTTGTCATAATGACTCCTGTTGATAGATCCAGTAATGACCTCA0
Length of fragment =  321   P(K)=P(K)/100

 125 A 1534 
 126 A 688 
 127 G 1020 
 128 C 1015 
 129 A 870 
 130 G 1014 
 131 C 876 
 132 A 892 
 133 C 917 
 134 T 873 
 135 T 832 
 136 T 908 
 137 A 976 
 138 A 1010 
 139 A 1019 
 140 C 1617 
 141 T 1768 
 142 G 945 
 143 T 1228 
 144 C 1497 
 145 G 1238 
 146 C 1630 
 147 T 1485 
 148 T 1330 
 149 G 1199 
 150 G 1575 
 151 T 1363 
 152 C 1993 
 153 A 1595 
 154 G 1511 
 155 A 1520 
 156 T 1514 
 157 C 1888 
 158 T 1569 
 159 G 1574 
 160 C 2203 
 161 G 1753 
 162 C 2084 
 163 C 2138 
 164 C 2556 
 165 G 2053 
 166 A 2025 
 167 A 2155 
 168 T 2282 
 169 A 2282 
 170 A 2213 
 171 G 2539 
 172 C 2740 
 173 C 2593 
 174 T 2343 
 175 C 3116 
 176 A 2860 
 177 A 2787 
 178 G 3382 
 179 C 3812 
 180 A 2674 
 181 G 3071 
 182 C 3310 
 183 A 2903 
 184 T 2703 
 185 A 2627 
 186 T 2624 
 187 T 2693 
 188 T 2602 
 189 G 2931 
 190 A 3104 
 191 T 3118 
 192 A 2959 
 193 G 3290 
 194 T 3351 
 195 C 5117 
 196 T 3402 
 197 G 2567 
 198 G 3474 
 199 C 6146 
 200 G 3292 
 201 T 3699 
 202 A 2938 
 203 A 2870 
 204 C 3425 
 205 C 3219 
 206 A 2675 
 207 T 2531 
 208 C 3150 
 209 A 2281 
 210 T 2748 
 211 C 4490 
 212 G 2949 
 213 A 2506 
 214 G 2784 
 215 A 2986 
 216 T 2474 
 217 C 3430 
 218 T 2283 
 219 G 2352 
 220 C 2579 
 221 C 2351 
 222 A 2124 
 223 C 2687 
 224 A 2161 
 225 T 2424 
 226 T 2171 
 227 A 2423 
 228 C 4175 
 229 G 2423 
 230 C 3257 
 231 T 2157 
 232 C 2642 
 233 C 3311 
 234 T 3245 
 235 G 2171 
 236 T 2286 
 237 C 2831 
 238 C 3302 
 239 G 2203 
 240 G 2556 
 241 C 3078 
 242 A 2392 
 243 A 2222 
 244 A 1920 
 245 G 2228 
 246 T 2056 
 247 T 2332 
 248 A 2401 
 249 C 2246 
 250 C 2473 
 251 T 2092 
 252 C 3001 
 253 T 2347 
 254 G 2590 
 255 C 2883 
 256 C 3256 
 257 G 2650 
 258 A 2449 
 259 A 2562 
 260 G 2953 
 261 T 3070 
 262 T 2951 
 263 G 3180 
 264 A 2797 
 265 G 3768 
 266 T 3972 
 267 A 3991 
 268 T 4935 
 269 T 5617 
 270 T 5810 
 271 T 6490 
 272 T 6239 
 273 G 8761 
 274 C 11031 
 275 T 10356 
 276 G 11886 
 277 T 13057 
 278 A 13675 
 279 T 18990 
 280 T 22084 
 281 T 22388 
 282 G 29413 
 283 T 28928 
 284 C 32161 
 285 A 19867 
 286 T 17921 
 287 A 9102 
 288 A 5678 
 289 T 3924 
 290 G 2405 
 291 A 1412 
 292 C 1414 
 293 T 1007 
 294 C 954 
 295 C 430 
 296 T 507 
 297 G 580 
 298 T 462 
 299 T 426 
 300 G 422 
 301 A 375 
 302 T 367 
 303 A 347 
 304 G 294 
 305 A 323 
 306 T 279 
 307 C 269 
 308 C 257 
 309 A 237 
 310 G 232 

MAX = 32161   MIN = 232 

Length from 5'-end
 125 A        ####
 126 A        #
 127 G        ##
 128 C        ##
 129 A        #
 130 G        ##
 131 C        ##
 132 A        ##
 133 C        ##
 134 T        #
 135 T        #
 136 T        ##
 137 A        ##
 138 A        ##
 139 A        ##
 140 C        ####
 141 T        ####
 142 G        ##
 143 T        ###
 144 C        ###
 145 G        ###
 146 C        ####
 147 T        ###
 148 T        ###
 149 G        ###
 150 G        ####
 151 T        ###
 152 C        #####
 153 A        ####
 154 G        ###
 155 A        ####
 156 T        ###
 157 C        #####
 158 T        ####
 159 G        ####
 160 C        ######
 161 G        ####
 162 C        #####
 163 C        #####
 164 C        #######
 165 G        #####
 166 A        #####
 167 A        #####
 168 T        ######
 169 A        ######
 170 A        ######
 171 G        #######
 172 C        #######
 173 C        #######
 174 T        ######
 175 C        ########
 176 A        ########
 177 A        #######
 178 G        #########
 179 C        ###########
 180 A        #######
 181 G        ########
 182 C        #########
 183 A        ########
 184 T        #######
 185 A        #######
 186 T        #######
 187 T        #######
 188 T        #######
 189 G        ########
 190 A        ########
 191 T        ########
 192 A        ########
 193 G        #########
 194 T        #########
 195 C        ###############
 196 T        #########
 197 G        #######
 198 G        ##########
 199 C        ##################
 200 G        #########
 201 T        ##########
 202 A        ########
 203 A        ########
 204 C        #########
 205 C        #########
 206 A        #######
 207 T        #######
 208 C        #########
 209 A        ######
 210 T        #######
 211 C        #############
 212 G        ########
 213 A        #######
 214 G        #######
 215 A        ########
 216 T        ######
 217 C        #########
 218 T        ######
 219 G        ######
 220 C        #######
 221 C        ######
 222 A        #####
 223 C        #######
 224 A        #####
 225 T        ######
 226 T        ######
 227 A        ######
 228 C        ############
 229 G        ######
 230 C        #########
 231 T        #####
 232 C        #######
 233 C        #########
 234 T        #########
 235 G        ######
 236 T        ######
 237 C        ########
 238 C        #########
 239 G        ######
 240 G        #######
 241 C        ########
 242 A        ######
 243 A        ######
 244 A        #####
 245 G        ######
 246 T        #####
 247 T        ######
 248 A        ######
 249 C        ######
 250 C        ######
 251 T        #####
 252 C        ########
 253 T        ######
 254 G        #######
 255 C        ########
 256 C        #########
 257 G        #######
 258 A        ######
 259 A        #######
 260 G        ########
 261 T        ########
 262 T        ########
 263 G        #########
 264 A        #######
 265 G        ##########
 266 T        ###########
 267 A        ###########
 268 T        ##############
 269 T        ################
 270 T        #################
 271 T        ###################
 272 T        ##################
 273 G        ##########################
 274 C        #################################
 275 T        ###############################
 276 G        ####################################
 277 T        #######################################
 278 A        #########################################
 279 T        ##########################################################
 280 T        ###################################################################
 281 T        ####################################################################
 282 G        ##########################################################################################
 283 T        #########################################################################################
 284 C        ###################################################################################################
 285 A        #############################################################
 286 T        #######################################################
 287 A        ###########################
 288 A        ################
 289 T        ###########
 290 G        ######
 291 A        ###
 292 C        ###
 293 T        ##
 294 C        ##
 295 C        
 296 T        
 297 G        #
 298 T        
 299 T        
 300 G        
 301 A        
 302 T        
 303 A        
 304 G        
 305 A        
 306 T        
 307 C        
 308 C        
 309 A        
 310 G        


Length from 3'-end
 197 A        ####
 196 A        #
 195 G        ##
 194 C        ##
 193 A        #
 192 G        ##
 191 C        ##
 190 A        ##
 189 C        ##
 188 T        #
 187 T        #
 186 T        ##
 185 A        ##
 184 A        ##
 183 A        ##
 182 C        ####
 181 T        ####
 180 G        ##
 179 T        ###
 178 C        ###
 177 G        ###
 176 C        ####
 175 T        ###
 174 T        ###
 173 G        ###
 172 G        ####
 171 T        ###
 170 C        #####
 169 A        ####
 168 G        ###
 167 A        ####
 166 T        ###
 165 C        #####
 164 T        ####
 163 G        ####
 162 C        ######
 161 G        ####
 160 C        #####
 159 C        #####
 158 C        #######
 157 G        #####
 156 A        #####
 155 A        #####
 154 T        ######
 153 A        ######
 152 A        ######
 151 G        #######
 150 C        #######
 149 C        #######
 148 T        ######
 147 C        ########
 146 A        ########
 145 A        #######
 144 G        #########
 143 C        ###########
 142 A        #######
 141 G        ########
 140 C        #########
 139 A        ########
 138 T        #######
 137 A        #######
 136 T        #######
 135 T        #######
 134 T        #######
 133 G        ########
 132 A        ########
 131 T        ########
 130 A        ########
 129 G        #########
 128 T        #########
 127 C        ###############
 126 T        #########
 125 G        #######
 124 G        ##########
 123 C        ##################
 122 G        #########
 121 T        ##########
 120 A        ########
 119 A        ########
 118 C        #########
 117 C        #########
 116 A        #######
 115 T        #######
 114 C        #########
 113 A        ######
 112 T        #######
 111 C        #############
 110 G        ########
 109 A        #######
 108 G        #######
 107 A        ########
 106 T        ######
 105 C        #########
 104 T        ######
 103 G        ######
 102 C        #######
 101 C        ######
 100 A        #####
 99 C         #######
 98 A         #####
 97 T         ######
 96 T         ######
 95 A         ######
 94 C         ############
 93 G         ######
 92 C         #########
 91 T         #####
 90 C         #######
 89 C         #########
 88 T         #########
 87 G         ######
 86 T         ######
 85 C         ########
 84 C         #########
 83 G         ######
 82 G         #######
 81 C         ########
 80 A         ######
 79 A         ######
 78 A         #####
 77 G         ######
 76 T         #####
 75 T         ######
 74 A         ######
 73 C         ######
 72 C         ######
 71 T         #####
 70 C         ########
 69 T         ######
 68 G         #######
 67 C         ########
 66 C         #########
 65 G         #######
 64 A         ######
 63 A         #######
 62 G         ########
 61 T         ########
 60 T         ########
 59 G         #########
 58 A         #######
 57 G         ##########
 56 T         ###########
 55 A         ###########
 54 T         ##############
 53 T         ################
 52 T         #################
 51 T         ###################
 50 T         ##################
 49 G         ##########################
 48 C         #################################
 47 T         ###############################
 46 G         ####################################
 45 T         #######################################
 44 A         #########################################
 43 T         ##########################################################
 42 T         ###################################################################
 41 T         ####################################################################
 40 G         ##########################################################################################
 39 T         #########################################################################################
 38 C         ###################################################################################################
 37 A         #############################################################
 36 T         #######################################################
 35 A         ###########################
 34 A         ################
 33 T         ###########
 32 G         ######
 31 A         ###
 30 C         ###
 29 T         ##
 28 C         ##
 27 C         
 26 T         
 25 G         #
 24 T         
 23 T         
 22 G         
 21 A         
 20 T         
 19 A         
 18 G         
 17 A         
 16 T         
 15 C         
 14 C         
 13 A         
 12 G         


Length from nick
-161 A        ####
-160 A        #
-159 G        ##
-158 C        ##
-157 A        #
-156 G        ##
-155 C        ##
-154 A        ##
-153 C        ##
-152 T        #
-151 T        #
-150 T        ##
-149 A        ##
-148 A        ##
-147 A        ##
-146 C        ####
-145 T        ####
-144 G        ##
-143 T        ###
-142 C        ###
-141 G        ###
-140 C        ####
-139 T        ###
-138 T        ###
-137 G        ###
-136 G        ####
-135 T        ###
-134 C        #####
-133 A        ####
-132 G        ###
-131 A        ####
-130 T        ###
-129 C        #####
-128 T        ####
-127 G        ####
-126 C        ######
-125 G        ####
-124 C        #####
-123 C        #####
-122 C        #######
-121 G        #####
-120 A        #####
-119 A        #####
-118 T        ######
-117 A        ######
-116 A        ######
-115 G        #######
-114 C        #######
-113 C        #######
-112 T        ######
-111 C        ########
-110 A        ########
-109 A        #######
-108 G        #########
-107 C        ###########
-106 A        #######
-105 G        ########
-104 C        #########
-103 A        ########
-102 T        #######
-101 A        #######
-100 T        #######
-99 T         #######
-98 T         #######
-97 G         ########
-96 A         ########
-95 T         ########
-94 A         ########
-93 G         #########
-92 T         #########
-91 C         ###############
-90 T         #########
-89 G         #######
-88 G         ##########
-87 C         ##################
-86 G         #########
-85 T         ##########
-84 A         ########
-83 A         ########
-82 C         #########
-81 C         #########
-80 A         #######
-79 T         #######
-78 C         #########
-77 A         ######
-76 T         #######
-75 C         #############
-74 G         ########
-73 A         #######
-72 G         #######
-71 A         ########
-70 T         ######
-69 C         #########
-68 T         ######
-67 G         ######
-66 C         #######
-65 C         ######
-64 A         #####
-63 C         #######
-62 A         #####
-61 T         ######
-60 T         ######
-59 A         ######
-58 C         ############
-57 G         ######
-56 C         #########
-55 T         #####
-54 C         #######
-53 C         #########
-52 T         #########
-51 G         ######
-50 T         ######
-49 C         ########
-48 C         #########
-47 G         ######
-46 G         #######
-45 C         ########
-44 A         ######
-43 A         ######
-42 A         #####
-41 G         ######
-40 T         #####
-39 T         ######
-38 A         ######
-37 C         ######
-36 C         ######
-35 T         #####
-34 C         ########
-33 T         ######
-32 G         #######
-31 C         ########
-30 C         #########
-29 G         #######
-28 A         ######
-27 A         #######
-26 G         ########
-25 T         ########
-24 T         ########
-23 G         #########
-22 A         #######
-21 G         ##########
-20 T         ###########
-19 A         ###########
-18 T         ##############
-17 T         ################
-16 T         #################
-15 T         ###################
-14 T         ##################
-13 G         ##########################
-12 C         #################################
-11 T         ###############################
-10 G         ####################################
-9 T          #######################################
-8 A          #########################################
-7 T          ##########################################################
-6 T          ###################################################################
-5 T          ####################################################################
-4 G          ##########################################################################################
-3 T          #########################################################################################
-2 C          ###################################################################################################
-1 A          #############################################################
 1 T          #######################################################
 2 A          ###########################
 3 A          ################
 4 T          ###########
 5 G          ######
 6 A          ###
 7 C          ###
 8 T          ##
 9 C          ##
 10 C         
 11 T         
 12 G         #
 13 T         
 14 T         
 15 G         
 16 A         
 17 T         
 18 A         
 19 G         
 20 A         
 21 T         
 22 C         
 23 C         
 24 A         
 25 G         


Name of gel and number of scan = No52a def.129 - 6% gel - 1h nickase
Name of sequence = pUC9G - Fragment-258-DdeI
Number of lanes =  5 
Lane for analysis =  4 
Number of analysing nucleotide =  186 
First analysing nucleotide =  125 
3'-nucleotide before nik =  285 
5'-TTCTGACGAGTTCTAACTTGGCTTCATTGCACCGTTTGACAGGTAACTTTGTAATCTCGCTAAGTTGAGAATCGGTGATTCTGTCCATTGGTTTATTCCACCCATAGGTTTTACGCAGAATGGCAAGCAGCACTTTAAACTGTCGCTTGGTCAGATCTGCGCCCGAATAAGCCTCAAGCAGCATATTTGATAGTCTGGCGTAACCATCATCGAGATCTGCCACATTACGCTCCTGTCCGGCAAAGTTACCTCTGCCGAAGTTGAGTATTTTTGCTGTATTTGTCATAATGACTCCTGTTGATAGATCCAGTAATGACCTCA0
Length of fragment =  321   P(K)=P(K)/100

 125 A 2321 
 126 A 1329 
 127 G 1804 
 128 C 1598 
 129 A 1395 
 130 G 1507 
 131 C 1301 
 132 A 1466 
 133 C 1473 
 134 T 1438 
 135 T 1404 
 136 T 1633 
 137 A 1734 
 138 A 1871 
 139 A 2192 
 140 C 1996 
 141 T 1799 
 142 G 1760 
 143 T 2033 
 144 C 2867 
 145 G 2428 
 146 C 3091 
 147 T 2920 
 148 T 2531 
 149 G 2150 
 150 G 2700 
 151 T 2559 
 152 C 3862 
 153 A 2782 
 154 G 2800 
 155 A 3154 
 156 T 2853 
 157 C 3667 
 158 T 2998 
 159 G 2885 
 160 C 4421 
 161 G 3372 
 162 C 4107 
 163 C 4351 
 164 C 5217 
 165 G 4084 
 166 A 4185 
 167 A 4333 
 168 T 4784 
 169 A 4664 
 170 A 4499 
 171 G 5003 
 172 C 5732 
 173 C 5216 
 174 T 4821 
 175 C 6452 
 176 A 5764 
 177 A 5697 
 178 G 6856 
 179 C 7921 
 180 A 5506 
 181 G 6336 
 182 C 6836 
 183 A 5725 
 184 T 5745 
 185 A 5361 
 186 T 5089 
 187 T 5422 
 188 T 5402 
 189 G 5963 
 190 A 6219 
 191 T 6643 
 192 A 6150 
 193 G 6530 
 194 T 7112 
 195 C 10766 
 196 T 7028 
 197 G 5134 
 198 G 7240 
 199 C 13590 
 200 G 6383 
 201 T 7702 
 202 A 5733 
 203 A 5469 
 204 C 6931 
 205 C 6577 
 206 A 4869 
 207 T 5068 
 208 C 6157 
 209 A 4230 
 210 T 5310 
 211 C 9088 
 212 G 5733 
 213 A 4810 
 214 G 5174 
 215 A 5678 
 216 T 4760 
 217 C 6596 
 218 T 4318 
 219 G 4071 
 220 C 4842 
 221 C 4435 
 222 A 3812 
 223 C 5072 
 224 A 3818 
 225 T 4351 
 226 T 3958 
 227 A 4157 
 228 C 8047 
 229 G 4075 
 230 C 5871 
 231 T 3590 
 232 C 4624 
 233 C 5917 
 234 T 5349 
 235 G 3429 
 236 T 3814 
 237 C 4843 
 238 C 5643 
 239 G 3403 
 240 G 4044 
 241 C 5214 
 242 A 3694 
 243 A 3284 
 244 A 2750 
 245 G 3151 
 246 T 2839 
 247 T 3293 
 248 A 3244 
 249 C 3033 
 250 C 3343 
 251 T 2752 
 252 C 4024 
 253 T 3193 
 254 G 3424 
 255 C 3747 
 256 C 4427 
 257 G 3262 
 258 A 2999 
 259 A 2996 
 260 G 3454 
 261 T 3453 
 262 T 3333 
 263 G 3593 
 264 A 3158 
 265 G 4261 
 266 T 4497 
 267 A 4709 
 268 T 5413 
 269 T 5748 
 270 T 6790 
 271 T 7883 
 272 T 7740 
 273 G 11136 
 274 C 14207 
 275 T 13098 
 276 G 15882 
 277 T 18749 
 278 A 20670 
 279 T 28562 
 280 T 33765 
 281 T 35441 
 282 G 47825 
 283 T 48159 
 284 C 54801 
 285 A 36622 
 286 T 32411 
 287 A 15858 
 288 A 8953 
 289 T 5896 
 290 G 3582 
 291 A 1994 
 292 C 1887 
 293 T 1347 
 294 C 1230 
 295 C 374 
 296 T 478 
 297 G 710 
 298 T 525 
 299 T 447 
 300 G 488 
 301 A 414 
 302 T 378 
 303 A 362 
 304 G 304 
 305 A 290 
 306 T 263 
 307 C 241 
 308 C 208 
 309 A 217 
 310 G 227 

MAX = 54801   MIN = 208 

Length from 5'-end
 125 A        ###
 126 A        ##
 127 G        ##
 128 C        ##
 129 A        ##
 130 G        ##
 131 C        #
 132 A        ##
 133 C        ##
 134 T        ##
 135 T        ##
 136 T        ##
 137 A        ##
 138 A        ###
 139 A        ###
 140 C        ###
 141 T        ##
 142 G        ##
 143 T        ###
 144 C        ####
 145 G        ####
 146 C        #####
 147 T        ####
 148 T        ####
 149 G        ###
 150 G        ####
 151 T        ####
 152 C        ######
 153 A        ####
 154 G        ####
 155 A        #####
 156 T        ####
 157 C        ######
 158 T        #####
 159 G        ####
 160 C        #######
 161 G        #####
 162 C        #######
 163 C        #######
 164 C        #########
 165 G        #######
 166 A        #######
 167 A        #######
 168 T        ########
 169 A        ########
 170 A        #######
 171 G        ########
 172 C        ##########
 173 C        #########
 174 T        ########
 175 C        ###########
 176 A        ##########
 177 A        ##########
 178 G        ############
 179 C        ##############
 180 A        #########
 181 G        ###########
 182 C        ############
 183 A        ##########
 184 T        ##########
 185 A        #########
 186 T        ########
 187 T        #########
 188 T        #########
 189 G        ##########
 190 A        ##########
 191 T        ###########
 192 A        ##########
 193 G        ###########
 194 T        ############
 195 C        ###################
 196 T        ############
 197 G        ########
 198 G        ############
 199 C        ########################
 200 G        ###########
 201 T        #############
 202 A        ##########
 203 A        #########
 204 C        ############
 205 C        ###########
 206 A        ########
 207 T        ########
 208 C        ##########
 209 A        #######
 210 T        #########
 211 C        ################
 212 G        ##########
 213 A        ########
 214 G        #########
 215 A        #########
 216 T        ########
 217 C        ###########
 218 T        #######
 219 G        #######
 220 C        ########
 221 C        #######
 222 A        ######
 223 C        ########
 224 A        ######
 225 T        #######
 226 T        ######
 227 A        #######
 228 C        ##############
 229 G        #######
 230 C        ##########
 231 T        ######
 232 C        ########
 233 C        ##########
 234 T        #########
 235 G        #####
 236 T        ######
 237 C        ########
 238 C        #########
 239 G        #####
 240 G        ######
 241 C        #########
 242 A        ######
 243 A        #####
 244 A        ####
 245 G        #####
 246 T        ####
 247 T        #####
 248 A        #####
 249 C        #####
 250 C        #####
 251 T        ####
 252 C        ######
 253 T        #####
 254 G        #####
 255 C        ######
 256 C        #######
 257 G        #####
 258 A        #####
 259 A        #####
 260 G        #####
 261 T        #####
 262 T        #####
 263 G        ######
 264 A        #####
 265 G        #######
 266 T        #######
 267 A        ########
 268 T        #########
 269 T        ##########
 270 T        ############
 271 T        ##############
 272 T        #############
 273 G        ###################
 274 C        #########################
 275 T        #######################
 276 G        ############################
 277 T        #################################
 278 A        #####################################
 279 T        ###################################################
 280 T        #############################################################
 281 T        ################################################################
 282 G        ######################################################################################
 283 T        #######################################################################################
 284 C        ###################################################################################################
 285 A        ##################################################################
 286 T        ##########################################################
 287 A        ############################
 288 A        ###############
 289 T        ##########
 290 G        ######
 291 A        ###
 292 C        ###
 293 T        ##
 294 C        #
 295 C        
 296 T        
 297 G        
 298 T        
 299 T        
 300 G        
 301 A        
 302 T        
 303 A        
 304 G        
 305 A        
 306 T        
 307 C        
 308 C        
 309 A        
 310 G        


Length from 3'-end
 197 A        ###
 196 A        ##
 195 G        ##
 194 C        ##
 193 A        ##
 192 G        ##
 191 C        #
 190 A        ##
 189 C        ##
 188 T        ##
 187 T        ##
 186 T        ##
 185 A        ##
 184 A        ###
 183 A        ###
 182 C        ###
 181 T        ##
 180 G        ##
 179 T        ###
 178 C        ####
 177 G        ####
 176 C        #####
 175 T        ####
 174 T        ####
 173 G        ###
 172 G        ####
 171 T        ####
 170 C        ######
 169 A        ####
 168 G        ####
 167 A        #####
 166 T        ####
 165 C        ######
 164 T        #####
 163 G        ####
 162 C        #######
 161 G        #####
 160 C        #######
 159 C        #######
 158 C        #########
 157 G        #######
 156 A        #######
 155 A        #######
 154 T        ########
 153 A        ########
 152 A        #######
 151 G        ########
 150 C        ##########
 149 C        #########
 148 T        ########
 147 C        ###########
 146 A        ##########
 145 A        ##########
 144 G        ############
 143 C        ##############
 142 A        #########
 141 G        ###########
 140 C        ############
 139 A        ##########
 138 T        ##########
 137 A        #########
 136 T        ########
 135 T        #########
 134 T        #########
 133 G        ##########
 132 A        ##########
 131 T        ###########
 130 A        ##########
 129 G        ###########
 128 T        ############
 127 C        ###################
 126 T        ############
 125 G        ########
 124 G        ############
 123 C        ########################
 122 G        ###########
 121 T        #############
 120 A        ##########
 119 A        #########
 118 C        ############
 117 C        ###########
 116 A        ########
 115 T        ########
 114 C        ##########
 113 A        #######
 112 T        #########
 111 C        ################
 110 G        ##########
 109 A        ########
 108 G        #########
 107 A        #########
 106 T        ########
 105 C        ###########
 104 T        #######
 103 G        #######
 102 C        ########
 101 C        #######
 100 A        ######
 99 C         ########
 98 A         ######
 97 T         #######
 96 T         ######
 95 A         #######
 94 C         ##############
 93 G         #######
 92 C         ##########
 91 T         ######
 90 C         ########
 89 C         ##########
 88 T         #########
 87 G         #####
 86 T         ######
 85 C         ########
 84 C         #########
 83 G         #####
 82 G         ######
 81 C         #########
 80 A         ######
 79 A         #####
 78 A         ####
 77 G         #####
 76 T         ####
 75 T         #####
 74 A         #####
 73 C         #####
 72 C         #####
 71 T         ####
 70 C         ######
 69 T         #####
 68 G         #####
 67 C         ######
 66 C         #######
 65 G         #####
 64 A         #####
 63 A         #####
 62 G         #####
 61 T         #####
 60 T         #####
 59 G         ######
 58 A         #####
 57 G         #######
 56 T         #######
 55 A         ########
 54 T         #########
 53 T         ##########
 52 T         ############
 51 T         ##############
 50 T         #############
 49 G         ###################
 48 C         #########################
 47 T         #######################
 46 G         ############################
 45 T         #################################
 44 A         #####################################
 43 T         ###################################################
 42 T         #############################################################
 41 T         ################################################################
 40 G         ######################################################################################
 39 T         #######################################################################################
 38 C         ###################################################################################################
 37 A         ##################################################################
 36 T         ##########################################################
 35 A         ############################
 34 A         ###############
 33 T         ##########
 32 G         ######
 31 A         ###
 30 C         ###
 29 T         ##
 28 C         #
 27 C         
 26 T         
 25 G         
 24 T         
 23 T         
 22 G         
 21 A         
 20 T         
 19 A         
 18 G         
 17 A         
 16 T         
 15 C         
 14 C         
 13 A         
 12 G         


Length from nick
-161 A        ###
-160 A        ##
-159 G        ##
-158 C        ##
-157 A        ##
-156 G        ##
-155 C        #
-154 A        ##
-153 C        ##
-152 T        ##
-151 T        ##
-150 T        ##
-149 A        ##
-148 A        ###
-147 A        ###
-146 C        ###
-145 T        ##
-144 G        ##
-143 T        ###
-142 C        ####
-141 G        ####
-140 C        #####
-139 T        ####
-138 T        ####
-137 G        ###
-136 G        ####
-135 T        ####
-134 C        ######
-133 A        ####
-132 G        ####
-131 A        #####
-130 T        ####
-129 C        ######
-128 T        #####
-127 G        ####
-126 C        #######
-125 G        #####
-124 C        #######
-123 C        #######
-122 C        #########
-121 G        #######
-120 A        #######
-119 A        #######
-118 T        ########
-117 A        ########
-116 A        #######
-115 G        ########
-114 C        ##########
-113 C        #########
-112 T        ########
-111 C        ###########
-110 A        ##########
-109 A        ##########
-108 G        ############
-107 C        ##############
-106 A        #########
-105 G        ###########
-104 C        ############
-103 A        ##########
-102 T        ##########
-101 A        #########
-100 T        ########
-99 T         #########
-98 T         #########
-97 G         ##########
-96 A         ##########
-95 T         ###########
-94 A         ##########
-93 G         ###########
-92 T         ############
-91 C         ###################
-90 T         ############
-89 G         ########
-88 G         ############
-87 C         ########################
-86 G         ###########
-85 T         #############
-84 A         ##########
-83 A         #########
-82 C         ############
-81 C         ###########
-80 A         ########
-79 T         ########
-78 C         ##########
-77 A         #######
-76 T         #########
-75 C         ################
-74 G         ##########
-73 A         ########
-72 G         #########
-71 A         #########
-70 T         ########
-69 C         ###########
-68 T         #######
-67 G         #######
-66 C         ########
-65 C         #######
-64 A         ######
-63 C         ########
-62 A         ######
-61 T         #######
-60 T         ######
-59 A         #######
-58 C         ##############
-57 G         #######
-56 C         ##########
-55 T         ######
-54 C         ########
-53 C         ##########
-52 T         #########
-51 G         #####
-50 T         ######
-49 C         ########
-48 C         #########
-47 G         #####
-46 G         ######
-45 C         #########
-44 A         ######
-43 A         #####
-42 A         ####
-41 G         #####
-40 T         ####
-39 T         #####
-38 A         #####
-37 C         #####
-36 C         #####
-35 T         ####
-34 C         ######
-33 T         #####
-32 G         #####
-31 C         ######
-30 C         #######
-29 G         #####
-28 A         #####
-27 A         #####
-26 G         #####
-25 T         #####
-24 T         #####
-23 G         ######
-22 A         #####
-21 G         #######
-20 T         #######
-19 A         ########
-18 T         #########
-17 T         ##########
-16 T         ############
-15 T         ##############
-14 T         #############
-13 G         ###################
-12 C         #########################
-11 T         #######################
-10 G         ############################
-9 T          #################################
-8 A          #####################################
-7 T          ###################################################
-6 T          #############################################################
-5 T          ################################################################
-4 G          ######################################################################################
-3 T          #######################################################################################
-2 C          ###################################################################################################
-1 A          ##################################################################
 1 T          ##########################################################
 2 A          ############################
 3 A          ###############
 4 T          ##########
 5 G          ######
 6 A          ###
 7 C          ###
 8 T          ##
 9 C          #
 10 C         
 11 T         
 12 G         
 13 T         
 14 T         
 15 G         
 16 A         
 17 T         
 18 A         
 19 G         
 20 A         
 21 T         
 22 C         
 23 C         
 24 A         
 25 G         


Name of gel and number of scan = No54  def.136
Name of sequence = Clon No1250
Number of lanes =  13 
Lane for analysis =  8 
Number of analysing nucleotide =  163 
First analysing nucleotide =  115 
3'-nucleotide before nik =  204 
5'-GCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTGTAATACGACTCACTATAGGGCGAATTGGGCCCGACGTCGCATGCTCCTCTAGACTCGAGGAATTCGGTACCCCCGTATCACCGGCGGTGATACGAATTCGTATCCCTTCGGTGATACGCTAGGGGTTCGCGTATCACCGCCGGTGATACGCGAAATC0
Length of fragment =  314   P(K)=P(K)/100

 115 G 18906 
 116 T 8708 
 117 T 9611 
 118 T 7855 
 119 T 8708 
 120 C 9648 
 121 C 10245 
 122 C 10310 
 123 A 8746 
 124 G 9984 
 125 T 9934 
 126 C 10470 
 127 A 10703 
 128 C 10970 
 129 G 11415 
 130 A 10584 
 131 C 10917 
 132 G 20016 
 133 T 9462 
 134 T 11954 
 135 G 12585 
 136 T 12772 
 137 A 12763 
 138 A 12734 
 139 A 14517 
 140 A 15465 
 141 C 20097 
 142 G 19709 
 143 A 20276 
 144 C 23653 
 145 G 24931 
 146 G 31755 
 147 C 34272 
 148 C 36784 
 149 A 39168 
 150 G 44732 
 151 T 46369 
 152 G 59565 
 153 A 66246 
 154 A 93425 
 155 T 123804 
 156 T 120395 
 157 G 157170 
 158 T 157754 
 159 A 163117 
 160 A 175116 
 161 T 173468 
 162 A 172770 
 163 C 156310 
 164 G 123379 
 165 A 93710 
 166 C 93991 
 167 T 73247 
 168 C 66094 
 169 A 51360 
 170 C 42023 
 171 T 38892 
 172 A 32617 
 173 T 33166 
 174 A 35808 
 175 G 40756 
 176 G 45638 
 177 G 2372 
 178 C 14878 
 179 G 28478 
 180 A 47076 
 181 A 40274 
 182 T 28289 
 183 T 36259 
 184 G 40552 
 185 G 18333 
 186 G 24386 
 187 C 21236 
 188 C 19506 
 189 C 20550 
 190 G 21401 
 191 A 27330 
 192 C 30315 
 193 G 27794 
 194 T 26285 
 195 C 25542 
 196 G 36231 
 197 C 34183 
 198 A 43536 
 199 T 46215 
 200 G 84709 
 201 C 88550 
 202 T 90675 
 203 C 113791 
 204 C 113910 
 205 T 141609 
 206 C 153171 
 207 T 125592 
 208 A 114199 
 209 G 105969 
 210 A 80785 
 211 C 66207 
 212 T 47320 
 213 C 40043 
 214 G 36851 
 215 A 28990 
 216 G 30990 
 217 G 23075 
 218 A 18328 
 219 A 17965 
 220 T 16479 
 221 T 15838 
 222 C 15381 
 223 G 16568 
 224 G 16906 
 225 T 15041 
 226 A 17292 
 227 C 15120 
 228 C 14149 
 229 C 14212 
 230 C 14333 
 231 C 13254 
 232 G 15057 
 233 T 13899 
 234 A 13002 
 235 T 14996 
 236 C 12634 
 237 A 13670 
 238 C 13001 
 239 C 12997 
 240 G 14712 
 241 G 15410 
 242 C 14137 
 243 G 14583 
 244 G 16522 
 245 T 13632 
 246 G 15711 
 247 A 14173 
 248 T 14140 
 249 A 16382 
 250 C 14663 
 251 G 15140 
 252 A 13268 
 253 A 13537 
 254 T 14243 
 255 T 13936 
 256 C 16578 
 257 G 15427 
 258 T 13919 
 259 A 14897 
 260 T 14748 
 261 C 14465 
 262 C 14127 
 263 C 14713 
 264 T 14369 
 265 T 15005 
 266 C 14706 
 267 G 13909 
 268 G 15689 
 269 T 12402 
 270 G 14687 
 271 A 11361 
 272 T 11760 
 273 A 12175 
 274 C 12343 
 275 G 12460 
 276 C 11269 
 277 T 12005 

MAX = 175116  MIN = 2372 

Length from 5'-end
 115 G        #########
 116 T        ###
 117 T        ####
 118 T        ###
 119 T        ###
 120 C        ####
 121 C        ####
 122 C        ####
 123 A        ###
 124 G        ####
 125 T        ####
 126 C        ####
 127 A        ####
 128 C        ####
 129 G        #####
 130 A        ####
 131 C        ####
 132 G        ##########
 133 T        ####
 134 T        #####
 135 G        #####
 136 T        #####
 137 A        #####
 138 A        #####
 139 A        ######
 140 A        #######
 141 C        ##########
 142 G        #########
 143 A        ##########
 144 C        ############
 145 G        ############
 146 G        ################
 147 C        ##################
 148 C        ###################
 149 A        #####################
 150 G        ########################
 151 T        #########################
 152 G        ################################
 153 A        ####################################
 154 A        ###################################################
 155 T        #####################################################################
 156 T        ###################################################################
 157 G        ########################################################################################
 158 T        ########################################################################################
 159 A        ###########################################################################################
 160 A        ##################################################################################################
 161 T        #################################################################################################
 162 A        #################################################################################################
 163 C        #######################################################################################
 164 G        #####################################################################
 165 A        ####################################################
 166 C        ####################################################
 167 T        ########################################
 168 C        ####################################
 169 A        ###########################
 170 C        ######################
 171 T        ####################
 172 A        #################
 173 T        #################
 174 A        ###################
 175 G        #####################
 176 G        ########################
 177 G        
 178 C        #######
 179 G        ##############
 180 A        #########################
 181 A        #####################
 182 T        ##############
 183 T        ###################
 184 G        #####################
 185 G        #########
 186 G        ############
 187 C        ##########
 188 C        #########
 189 C        ##########
 190 G        ##########
 191 A        ##############
 192 C        ###############
 193 G        ##############
 194 T        #############
 195 C        #############
 196 G        ###################
 197 C        ##################
 198 A        #######################
 199 T        #########################
 200 G        ###############################################
 201 C        #################################################
 202 T        ##################################################
 203 C        ###############################################################
 204 C        ###############################################################
 205 T        ###############################################################################
 206 C        ######################################################################################
 207 T        ######################################################################
 208 A        ###############################################################
 209 G        ###########################################################
 210 A        ############################################
 211 C        ####################################
 212 T        #########################
 213 C        #####################
 214 G        ###################
 215 A        ###############
 216 G        ################
 217 G        ###########
 218 A        #########
 219 A        ########
 220 T        ########
 221 T        #######
 222 C        #######
 223 G        ########
 224 G        ########
 225 T        #######
 226 A        ########
 227 C        #######
 228 C        ######
 229 C        ######
 230 C        ######
 231 C        ######
 232 G        #######
 233 T        ######
 234 A        ######
 235 T        #######
 236 C        #####
 237 A        ######
 238 C        ######
 239 C        ######
 240 G        #######
 241 G        #######
 242 C        ######
 243 G        ######
 244 G        ########
 245 T        ######
 246 G        #######
 247 A        ######
 248 T        ######
 249 A        ########
 250 C        #######
 251 G        #######
 252 A        ######
 253 A        ######
 254 T        ######
 255 T        ######
 256 C        ########
 257 G        #######
 258 T        ######
 259 A        #######
 260 T        #######
 261 C        ######
 262 C        ######
 263 C        #######
 264 T        ######
 265 T        #######
 266 C        #######
 267 G        ######
 268 G        #######
 269 T        #####
 270 G        #######
 271 A        #####
 272 T        #####
 273 A        #####
 274 C        #####
 275 G        #####
 276 C        #####
 277 T        #####


Length from 3'-end
 200 G        #########
 199 T        ###
 198 T        ####
 197 T        ###
 196 T        ###
 195 C        ####
 194 C        ####
 193 C        ####
 192 A        ###
 191 G        ####
 190 T        ####
 189 C        ####
 188 A        ####
 187 C        ####
 186 G        #####
 185 A        ####
 184 C        ####
 183 G        ##########
 182 T        ####
 181 T        #####
 180 G        #####
 179 T        #####
 178 A        #####
 177 A        #####
 176 A        ######
 175 A        #######
 174 C        ##########
 173 G        #########
 172 A        ##########
 171 C        ############
 170 G        ############
 169 G        ################
 168 C        ##################
 167 C        ###################
 166 A        #####################
 165 G        ########################
 164 T        #########################
 163 G        ################################
 162 A        ####################################
 161 A        ###################################################
 160 T        #####################################################################
 159 T        ###################################################################
 158 G        ########################################################################################
 157 T        ########################################################################################
 156 A        ###########################################################################################
 155 A        ##################################################################################################
 154 T        #################################################################################################
 153 A        #################################################################################################
 152 C        #######################################################################################
 151 G        #####################################################################
 150 A        ####################################################
 149 C        ####################################################
 148 T        ########################################
 147 C        ####################################
 146 A        ###########################
 145 C        ######################
 144 T        ####################
 143 A        #################
 142 T        #################
 141 A        ###################
 140 G        #####################
 139 G        ########################
 138 G        
 137 C        #######
 136 G        ##############
 135 A        #########################
 134 A        #####################
 133 T        ##############
 132 T        ###################
 131 G        #####################
 130 G        #########
 129 G        ############
 128 C        ##########
 127 C        #########
 126 C        ##########
 125 G        ##########
 124 A        ##############
 123 C        ###############
 122 G        ##############
 121 T        #############
 120 C        #############
 119 G        ###################
 118 C        ##################
 117 A        #######################
 116 T        #########################
 115 G        ###############################################
 114 C        #################################################
 113 T        ##################################################
 112 C        ###############################################################
 111 C        ###############################################################
 110 T        ###############################################################################
 109 C        ######################################################################################
 108 T        ######################################################################
 107 A        ###############################################################
 106 G        ###########################################################
 105 A        ############################################
 104 C        ####################################
 103 T        #########################
 102 C        #####################
 101 G        ###################
 100 A        ###############
 99 G         ################
 98 G         ###########
 97 A         #########
 96 A         ########
 95 T         ########
 94 T         #######
 93 C         #######
 92 G         ########
 91 G         ########
 90 T         #######
 89 A         ########
 88 C         #######
 87 C         ######
 86 C         ######
 85 C         ######
 84 C         ######
 83 G         #######
 82 T         ######
 81 A         ######
 80 T         #######
 79 C         #####
 78 A         ######
 77 C         ######
 76 C         ######
 75 G         #######
 74 G         #######
 73 C         ######
 72 G         ######
 71 G         ########
 70 T         ######
 69 G         #######
 68 A         ######
 67 T         ######
 66 A         ########
 65 C         #######
 64 G         #######
 63 A         ######
 62 A         ######
 61 T         ######
 60 T         ######
 59 C         ########
 58 G         #######
 57 T         ######
 56 A         #######
 55 T         #######
 54 C         ######
 53 C         ######
 52 C         #######
 51 T         ######
 50 T         #######
 49 C         #######
 48 G         ######
 47 G         #######
 46 T         #####
 45 G         #######
 44 A         #####
 43 T         #####
 42 A         #####
 41 C         #####
 40 G         #####
 39 C         #####
 38 T         #####


Length from nick
-90 G         #########
-89 T         ###
-88 T         ####
-87 T         ###
-86 T         ###
-85 C         ####
-84 C         ####
-83 C         ####
-82 A         ###
-81 G         ####
-80 T         ####
-79 C         ####
-78 A         ####
-77 C         ####
-76 G         #####
-75 A         ####
-74 C         ####
-73 G         ##########
-72 T         ####
-71 T         #####
-70 G         #####
-69 T         #####
-68 A         #####
-67 A         #####
-66 A         ######
-65 A         #######
-64 C         ##########
-63 G         #########
-62 A         ##########
-61 C         ############
-60 G         ############
-59 G         ################
-58 C         ##################
-57 C         ###################
-56 A         #####################
-55 G         ########################
-54 T         #########################
-53 G         ################################
-52 A         ####################################
-51 A         ###################################################
-50 T         #####################################################################
-49 T         ###################################################################
-48 G         ########################################################################################
-47 T         ########################################################################################
-46 A         ###########################################################################################
-45 A         ##################################################################################################
-44 T         #################################################################################################
-43 A         #################################################################################################
-42 C         #######################################################################################
-41 G         #####################################################################
-40 A         ####################################################
-39 C         ####################################################
-38 T         ########################################
-37 C         ####################################
-36 A         ###########################
-35 C         ######################
-34 T         ####################
-33 A         #################
-32 T         #################
-31 A         ###################
-30 G         #####################
-29 G         ########################
-28 G         
-27 C         #######
-26 G         ##############
-25 A         #########################
-24 A         #####################
-23 T         ##############
-22 T         ###################
-21 G         #####################
-20 G         #########
-19 G         ############
-18 C         ##########
-17 C         #########
-16 C         ##########
-15 G         ##########
-14 A         ##############
-13 C         ###############
-12 G         ##############
-11 T         #############
-10 C         #############
-9 G          ###################
-8 C          ##################
-7 A          #######################
-6 T          #########################
-5 G          ###############################################
-4 C          #################################################
-3 T          ##################################################
-2 C          ###############################################################
-1 C          ###############################################################
 1 T          ###############################################################################
 2 C          ######################################################################################
 3 T          ######################################################################
 4 A          ###############################################################
 5 G          ###########################################################
 6 A          ############################################
 7 C          ####################################
 8 T          #########################
 9 C          #####################
 10 G         ###################
 11 A         ###############
 12 G         ################
 13 G         ###########
 14 A         #########
 15 A         ########
 16 T         ########
 17 T         #######
 18 C         #######
 19 G         ########
 20 G         ########
 21 T         #######
 22 A         ########
 23 C         #######
 24 C         ######
 25 C         ######
 26 C         ######
 27 C         ######
 28 G         #######
 29 T         ######
 30 A         ######
 31 T         #######
 32 C         #####
 33 A         ######
 34 C         ######
 35 C         ######
 36 G         #######
 37 G         #######
 38 C         ######
 39 G         ######
 40 G         ########
 41 T         ######
 42 G         #######
 43 A         ######
 44 T         ######
 45 A         ########
 46 C         #######
 47 G         #######
 48 A         ######
 49 A         ######
 50 T         ######
 51 T         ######
 52 C         ########
 53 G         #######
 54 T         ######
 55 A         #######
 56 T         #######
 57 C         ######
 58 C         ######
 59 C         #######
 60 T         ######
 61 T         #######
 62 C         #######
 63 G         ######
 64 G         #######
 65 T         #####
 66 G         #######
 67 A         #####
 68 T         #####
 69 A         #####
 70 C         #####
 71 G         #####
 72 C         #####
 73 T         #####


Name of gel and number of scan = No54 def.136
Name of sequence = Clon No 1250
Number of lanes =  13 
Lane for analysis =  8 
Number of analysing nucleotide =  163 
First analysing nucleotide =  115 
3'-nucleotide before nik =  159 
5'-GCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTGTAATACGACTCACTATAGGGCGAATTGGGCCCGACGTCGCATGCTCCTCTAGACTCGAGGAATTCGGTACCCCCGTATCACCGGCGGTGATACGAATTCGTATCCCTTCGGTGATACGCTAGGGGTTCGCGTATCACCGCCGGTGATACGCGAAATC0
Length of fragment =  314   P(K)=P(K)/100

 115 G 18906 
 116 T 8708 
 117 T 9611 
 118 T 7855 
 119 T 8708 
 120 C 9648 
 121 C 10245 
 122 C 10310 
 123 A 8746 
 124 G 9984 
 125 T 9934 
 126 C 10470 
 127 A 10703 
 128 C 10970 
 129 G 11415 
 130 A 10584 
 131 C 10917 
 132 G 20016 
 133 T 9462 
 134 T 11954 
 135 G 12585 
 136 T 12772 
 137 A 12763 
 138 A 12734 
 139 A 14517 
 140 A 15465 
 141 C 20097 
 142 G 19709 
 143 A 20276 
 144 C 23653 
 145 G 24931 
 146 G 31755 
 147 C 34272 
 148 C 36784 
 149 A 39168 
 150 G 44732 
 151 T 46369 
 152 G 59565 
 153 A 66246 
 154 A 93425 
 155 T 123804 
 156 T 120395 
 157 G 157170 
 158 T 157754 
 159 A 163117 
 160 A 175116 
 161 T 173468 
 162 A 172770 
 163 C 156310 
 164 G 123379 
 165 A 93710 
 166 C 93991 
 167 T 73247 
 168 C 66094 
 169 A 51360 
 170 C 42023 
 171 T 38892 
 172 A 32617 
 173 T 33166 
 174 A 35808 
 175 G 40756 
 176 G 45638 
 177 G 2372 
 178 C 14878 
 179 G 28478 
 180 A 47076 
 181 A 40274 
 182 T 28289 
 183 T 36259 
 184 G 40552 
 185 G 18333 
 186 G 24386 
 187 C 21236 
 188 C 19506 
 189 C 20550 
 190 G 21401 
 191 A 27330 
 192 C 30315 
 193 G 27794 
 194 T 26285 
 195 C 25542 
 196 G 36231 
 197 C 34183 
 198 A 43536 
 199 T 46215 
 200 G 84709 
 201 C 88550 
 202 T 90675 
 203 C 113791 
 204 C 113910 
 205 T 141609 
 206 C 153171 
 207 T 125592 
 208 A 114199 
 209 G 105969 
 210 A 80785 
 211 C 66207 
 212 T 47320 
 213 C 40043 
 214 G 36851 
 215 A 28990 
 216 G 30990 
 217 G 23075 
 218 A 18328 
 219 A 17965 
 220 T 16479 
 221 T 15838 
 222 C 15381 
 223 G 16568 
 224 G 16906 
 225 T 15041 
 226 A 17292 
 227 C 15120 
 228 C 14149 
 229 C 14212 
 230 C 14333 
 231 C 13254 
 232 G 15057 
 233 T 13899 
 234 A 13002 
 235 T 14996 
 236 C 12634 
 237 A 13670 
 238 C 13001 
 239 C 12997 
 240 G 14712 
 241 G 15410 
 242 C 14137 
 243 G 14583 
 244 G 16522 
 245 T 13632 
 246 G 15711 
 247 A 14173 
 248 T 14140 
 249 A 16382 
 250 C 14663 
 251 G 15140 
 252 A 13268 
 253 A 13537 
 254 T 14243 
 255 T 13936 
 256 C 16578 
 257 G 15427 
 258 T 13919 
 259 A 14897 
 260 T 14748 
 261 C 14465 
 262 C 14127 
 263 C 14713 
 264 T 14369 
 265 T 15005 
 266 C 14706 
 267 G 13909 
 268 G 15689 
 269 T 12402 
 270 G 14687 
 271 A 11361 
 272 T 11760 
 273 A 12175 
 274 C 12343 
 275 G 12460 
 276 C 11269 
 277 T 12005 

MAX = 175116  MIN = 2372 

Length from 5'-end
 115 G        #########
 116 T        ###
 117 T        ####
 118 T        ###
 119 T        ###
 120 C        ####
 121 C        ####
 122 C        ####
 123 A        ###
 124 G        ####
 125 T        ####
 126 C        ####
 127 A        ####
 128 C        ####
 129 G        #####
 130 A        ####
 131 C        ####
 132 G        ##########
 133 T        ####
 134 T        #####
 135 G        #####
 136 T        #####
 137 A        #####
 138 A        #####
 139 A        ######
 140 A        #######
 141 C        ##########
 142 G        #########
 143 A        ##########
 144 C        ############
 145 G        ############
 146 G        ################
 147 C        ##################
 148 C        ###################
 149 A        #####################
 150 G        ########################
 151 T        #########################
 152 G        ################################
 153 A        ####################################
 154 A        ###################################################
 155 T        #####################################################################
 156 T        ###################################################################
 157 G        ########################################################################################
 158 T        ########################################################################################
 159 A        ###########################################################################################
 160 A        ##################################################################################################
 161 T        #################################################################################################
 162 A        #################################################################################################
 163 C        #######################################################################################
 164 G        #####################################################################
 165 A        ####################################################
 166 C        ####################################################
 167 T        ########################################
 168 C        ####################################
 169 A        ###########################
 170 C        ######################
 171 T        ####################
 172 A        #################
 173 T        #################
 174 A        ###################
 175 G        #####################
 176 G        ########################
 177 G        
 178 C        #######
 179 G        ##############
 180 A        #########################
 181 A        #####################
 182 T        ##############
 183 T        ###################
 184 G        #####################
 185 G        #########
 186 G        ############
 187 C        ##########
 188 C        #########
 189 C        ##########
 190 G        ##########
 191 A        ##############
 192 C        ###############
 193 G        ##############
 194 T        #############
 195 C        #############
 196 G        ###################
 197 C        ##################
 198 A        #######################
 199 T        #########################
 200 G        ###############################################
 201 C        #################################################
 202 T        ##################################################
 203 C        ###############################################################
 204 C        ###############################################################
 205 T        ###############################################################################
 206 C        ######################################################################################
 207 T        ######################################################################
 208 A        ###############################################################
 209 G        ###########################################################
 210 A        ############################################
 211 C        ####################################
 212 T        #########################
 213 C        #####################
 214 G        ###################
 215 A        ###############
 216 G        ################
 217 G        ###########
 218 A        #########
 219 A        ########
 220 T        ########
 221 T        #######
 222 C        #######
 223 G        ########
 224 G        ########
 225 T        #######
 226 A        ########
 227 C        #######
 228 C        ######
 229 C        ######
 230 C        ######
 231 C        ######
 232 G        #######
 233 T        ######
 234 A        ######
 235 T        #######
 236 C        #####
 237 A        ######
 238 C        ######
 239 C        ######
 240 G        #######
 241 G        #######
 242 C        ######
 243 G        ######
 244 G        ########
 245 T        ######
 246 G        #######
 247 A        ######
 248 T        ######
 249 A        ########
 250 C        #######
 251 G        #######
 252 A        ######
 253 A        ######
 254 T        ######
 255 T        ######
 256 C        ########
 257 G        #######
 258 T        ######
 259 A        #######
 260 T        #######
 261 C        ######
 262 C        ######
 263 C        #######
 264 T        ######
 265 T        #######
 266 C        #######
 267 G        ######
 268 G        #######
 269 T        #####
 270 G        #######
 271 A        #####
 272 T        #####
 273 A        #####
 274 C        #####
 275 G        #####
 276 C        #####
 277 T        #####


Length from 3'-end
 200 G        #########
 199 T        ###
 198 T        ####
 197 T        ###
 196 T        ###
 195 C        ####
 194 C        ####
 193 C        ####
 192 A        ###
 191 G        ####
 190 T        ####
 189 C        ####
 188 A        ####
 187 C        ####
 186 G        #####
 185 A        ####
 184 C        ####
 183 G        ##########
 182 T        ####
 181 T        #####
 180 G        #####
 179 T        #####
 178 A        #####
 177 A        #####
 176 A        ######
 175 A        #######
 174 C        ##########
 173 G        #########
 172 A        ##########
 171 C        ############
 170 G        ############
 169 G        ################
 168 C        ##################
 167 C        ###################
 166 A        #####################
 165 G        ########################
 164 T        #########################
 163 G        ################################
 162 A        ####################################
 161 A        ###################################################
 160 T        #####################################################################
 159 T        ###################################################################
 158 G        ########################################################################################
 157 T        ########################################################################################
 156 A        ###########################################################################################
 155 A        ##################################################################################################
 154 T        #################################################################################################
 153 A        #################################################################################################
 152 C        #######################################################################################
 151 G        #####################################################################
 150 A        ####################################################
 149 C        ####################################################
 148 T        ########################################
 147 C        ####################################
 146 A        ###########################
 145 C        ######################
 144 T        ####################
 143 A        #################
 142 T        #################
 141 A        ###################
 140 G        #####################
 139 G        ########################
 138 G        
 137 C        #######
 136 G        ##############
 135 A        #########################
 134 A        #####################
 133 T        ##############
 132 T        ###################
 131 G        #####################
 130 G        #########
 129 G        ############
 128 C        ##########
 127 C        #########
 126 C        ##########
 125 G        ##########
 124 A        ##############
 123 C        ###############
 122 G        ##############
 121 T        #############
 120 C        #############
 119 G        ###################
 118 C        ##################
 117 A        #######################
 116 T        #########################
 115 G        ###############################################
 114 C        #################################################
 113 T        ##################################################
 112 C        ###############################################################
 111 C        ###############################################################
 110 T        ###############################################################################
 109 C        ######################################################################################
 108 T        ######################################################################
 107 A        ###############################################################
 106 G        ###########################################################
 105 A        ############################################
 104 C        ####################################
 103 T        #########################
 102 C        #####################
 101 G        ###################
 100 A        ###############
 99 G         ################
 98 G         ###########
 97 A         #########
 96 A         ########
 95 T         ########
 94 T         #######
 93 C         #######
 92 G         ########
 91 G         ########
 90 T         #######
 89 A         ########
 88 C         #######
 87 C         ######
 86 C         ######
 85 C         ######
 84 C         ######
 83 G         #######
 82 T         ######
 81 A         ######
 80 T         #######
 79 C         #####
 78 A         ######
 77 C         ######
 76 C         ######
 75 G         #######
 74 G         #######
 73 C         ######
 72 G         ######
 71 G         ########
 70 T         ######
 69 G         #######
 68 A         ######
 67 T         ######
 66 A         ########
 65 C         #######
 64 G         #######
 63 A         ######
 62 A         ######
 61 T         ######
 60 T         ######
 59 C         ########
 58 G         #######
 57 T         ######
 56 A         #######
 55 T         #######
 54 C         ######
 53 C         ######
 52 C         #######
 51 T         ######
 50 T         #######
 49 C         #######
 48 G         ######
 47 G         #######
 46 T         #####
 45 G         #######
 44 A         #####
 43 T         #####
 42 A         #####
 41 C         #####
 40 G         #####
 39 C         #####
 38 T         #####


Length from nick
-45 G         #########
-44 T         ###
-43 T         ####
-42 T         ###
-41 T         ###
-40 C         ####
-39 C         ####
-38 C         ####
-37 A         ###
-36 G         ####
-35 T         ####
-34 C         ####
-33 A         ####
-32 C         ####
-31 G         #####
-30 A         ####
-29 C         ####
-28 G         ##########
-27 T         ####
-26 T         #####
-25 G         #####
-24 T         #####
-23 A         #####
-22 A         #####
-21 A         ######
-20 A         #######
-19 C         ##########
-18 G         #########
-17 A         ##########
-16 C         ############
-15 G         ############
-14 G         ################
-13 C         ##################
-12 C         ###################
-11 A         #####################
-10 G         ########################
-9 T          #########################
-8 G          ################################
-7 A          ####################################
-6 A          ###################################################
-5 T          #####################################################################
-4 T          ###################################################################
-3 G          ########################################################################################
-2 T          ########################################################################################
-1 A          ###########################################################################################
 1 A          ##################################################################################################
 2 T          #################################################################################################
 3 A          #################################################################################################
 4 C          #######################################################################################
 5 G          #####################################################################
 6 A          ####################################################
 7 C          ####################################################
 8 T          ########################################
 9 C          ####################################
 10 A         ###########################
 11 C         ######################
 12 T         ####################
 13 A         #################
 14 T         #################
 15 A         ###################
 16 G         #####################
 17 G         ########################
 18 G         
 19 C         #######
 20 G         ##############
 21 A         #########################
 22 A         #####################
 23 T         ##############
 24 T         ###################
 25 G         #####################
 26 G         #########
 27 G         ############
 28 C         ##########
 29 C         #########
 30 C         ##########
 31 G         ##########
 32 A         ##############
 33 C         ###############
 34 G         ##############
 35 T         #############
 36 C         #############
 37 G         ###################
 38 C         ##################
 39 A         #######################
 40 T         #########################
 41 G         ###############################################
 42 C         #################################################
 43 T         ##################################################
 44 C         ###############################################################
 45 C         ###############################################################
 46 T         ###############################################################################
 47 C         ######################################################################################
 48 T         ######################################################################
 49 A         ###############################################################
 50 G         ###########################################################
 51 A         ############################################
 52 C         ####################################
 53 T         #########################
 54 C         #####################
 55 G         ###################
 56 A         ###############
 57 G         ################
 58 G         ###########
 59 A         #########
 60 A         ########
 61 T         ########
 62 T         #######
 63 C         #######
 64 G         ########
 65 G         ########
 66 T         #######
 67 A         ########
 68 C         #######
 69 C         ######
 70 C         ######
 71 C         ######
 72 C         ######
 73 G         #######
 74 T         ######
 75 A         ######
 76 T         #######
 77 C         #####
 78 A         ######
 79 C         ######
 80 C         ######
 81 G         #######
 82 G         #######
 83 C         ######
 84 G         ######
 85 G         ########
 86 T         ######
 87 G         #######
 88 A         ######
 89 T         ######
 90 A         ########
 91 C         #######
 92 G         #######
 93 A         ######
 94 A         ######
 95 T         ######
 96 T         ######
 97 C         ########
 98 G         #######
 99 T         ######
 100 A        #######
 101 T        #######
 102 C        ######
 103 C        ######
 104 C        #######
 105 T        ######
 106 T        #######
 107 C        #######
 108 G        ######
 109 G        #######
 110 T        #####
 111 G        #######
 112 A        #####
 113 T        #####
 114 A        #####
 115 C        #####
 116 G        #####
 117 C        #####
 118 T        #####


Name of gel and number of scan = No57 def.098
Name of sequence = Clon No 1647
Number of lanes =  15 
Lane for analysis =  8 
Number of analysing nucleotide =  209 
First analysing nucleotide =  72 
3'-nucleotide before nik =  196 
5'-GGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTGTAATACGACTCACTATAGGGCGAATTGGGCCCGACGTCGCATGCTCCTCTAGACTCGAGGAATTCGGTACCCCCGTATCACCGGCGGTGATACGAATTCGTATCCCTTCGGTGATACGCTAGGGGTTCGTATCACCGCCGGTGATACGCGAAATCGCGATAAGCTTGGATC0
Length of fragment =  320   P(K)=P(K)/100

 72 T 379 
 73 G 18 
 74 T 1747 
 75 G 406 
 76 C 432 
 77 T 462 
 78 G 495 
 79 C 520 
 80 A 464 
 81 A 474 
 82 G 536 
 83 G 635 
 84 C 631 
 85 G 517 
 86 A 460 
 87 T 407 
 88 T 390 
 89 A 377 
 90 A 628 
 91 G 747 
 92 T 699 
 93 T 621 
 94 G 581 
 95 G 606 
 96 G 640 
 97 T 650 
 98 A 668 
 99 A 650 
 100 C 740 
 101 G 644 
 102 C 531 
 103 C 597 
 104 A 680 
 105 G 778 
 106 G 832 
 107 G 735 
 108 T 702 
 109 T 616 
 110 T 641 
 111 T 676 
 112 C 693 
 113 C 688 
 114 C 712 
 115 A 834 
 116 G 827 
 117 T 837 
 118 C 785 
 119 A 754 
 120 C 728 
 121 G 508 
 122 A 189 
 123 C 436 
 124 G 872 
 125 T 650 
 126 T 2210 
 127 G 6945 
 128 T 692 
 129 A 907 
 130 A 1530 
 131 A 1278 
 132 A 1240 
 133 C 1387 
 134 G 2319 
 135 A 1560 
 136 C 1813 
 137 G 2423 
 138 G 3256 
 139 C 2391 
 140 C 2901 
 141 A 3616 
 142 G 4310 
 143 T 4312 
 144 G 6654 
 145 A 7409 
 146 A 9645 
 147 T 12052 
 148 T 13296 
 149 G 16038 
 150 T 19430 
 151 A 20872 
 152 A 20015 
 153 T 21039 
 154 A 22223 
 155 C 20176 
 156 G 14524 
 157 A 12279 
 158 C 11937 
 159 T 9398 
 160 C 9002 
 161 A 8060 
 162 C 7854 
 163 T 5575 
 164 A 3806 
 165 T 3707 
 166 A 3439 
 167 G 3004 
 168 G 1974 
 169 G 2286 
 170 C 2092 
 171 G 2239 
 172 A 1706 
 173 A 1839 
 174 T 1930 
 175 T 1629 
 176 G 1932 
 177 G 1968 
 178 G 2006 
 179 C 1886 
 180 C 1860 
 181 C 2041 
 182 G 2471 
 183 A 2626 
 184 C 2958 
 185 G 3294 
 186 T 3620 
 187 C 3819 
 188 G 6257 
 189 C 6109 
 190 A 7176 
 191 T 8526 
 192 G 16050 
 193 C 18963 
 194 T 18417 
 195 C 25755 
 196 C 23735 
 197 T 35565 
 198 C 35770 
 199 T 29241 
 200 A 28933 
 201 G 28841 
 202 A 21310 
 203 C 15644 
 204 T 11221 
 205 C 10095 
 206 G 8441 
 207 A 4929 
 208 G 4569 
 209 G 3705 
 210 A 2557 
 211 A 2195 
 212 T 1652 
 213 T 1369 
 214 C 1496 
 215 G 1949 
 216 G 1943 
 217 T 1267 
 218 A 1609 
 219 C 1373 
 220 C 1508 
 221 C 1450 
 222 C 1289 
 223 C 1229 
 224 G 1787 
 225 T 1174 
 226 A 1447 
 227 T 1202 
 228 C 1202 
 229 A 1504 
 230 C 1285 
 231 C 1384 
 232 G 1721 
 233 G 1814 
 234 C 1516 
 235 G 1934 
 236 G 1794 
 237 T 1381 
 238 G 1969 
 239 A 1626 
 240 T 1424 
 241 A 1835 
 242 C 1556 
 243 G 1960 
 244 A 1583 
 245 A 1667 
 246 T 1455 
 247 T 1490 
 248 C 1826 
 249 G 2175 
 250 T 1792 
 251 A 1960 
 252 T 1839 
 253 C 1900 
 254 C 1985 
 255 C 2217 
 256 T 2084 
 257 T 2136 
 258 C 2415 
 259 G 2540 
 260 G 2495 
 261 T 2086 
 262 G 2550 
 263 A 2151 
 264 T 2057 
 265 A 2298 
 266 C 2545 
 267 G 2566 
 268 C 2277 
 269 T 2018 
 270 A 2029 
 271 G 2165 
 272 G 2073 
 273 G 2165 
 274 G 2192 
 275 T 1747 
 276 T 1014 
 277 C 1406 
 278 G 3348 
 279 T 1824 
 280 A 2429 

MAX = 35770   MIN = 18 

Length from 5'-end
 72 T         #
 73 G         
 74 T         ####
 75 G         #
 76 C         #
 77 T         #
 78 G         #
 79 C         #
 80 A         #
 81 A         #
 82 G         #
 83 G         #
 84 C         #
 85 G         #
 86 A         #
 87 T         #
 88 T         #
 89 A         #
 90 A         #
 91 G         ##
 92 T         #
 93 T         #
 94 G         #
 95 G         #
 96 G         #
 97 T         #
 98 A         #
 99 A         #
 100 C        ##
 101 G        #
 102 C        #
 103 C        #
 104 A        #
 105 G        ##
 106 G        ##
 107 G        ##
 108 T        #
 109 T        #
 110 T        #
 111 T        #
 112 C        #
 113 C        #
 114 C        #
 115 A        ##
 116 G        ##
 117 T        ##
 118 C        ##
 119 A        ##
 120 C        #
 121 G        #
 122 A        
 123 C        #
 124 G        ##
 125 T        #
 126 T        ######
 127 G        ###################
 128 T        #
 129 A        ##
 130 A        ####
 131 A        ###
 132 A        ###
 133 C        ###
 134 G        ######
 135 A        ####
 136 C        #####
 137 G        ######
 138 G        #########
 139 C        ######
 140 C        ########
 141 A        ##########
 142 G        ###########
 143 T        ############
 144 G        ##################
 145 A        ####################
 146 A        ##########################
 147 T        #################################
 148 T        #####################################
 149 G        ############################################
 150 T        ######################################################
 151 A        ##########################################################
 152 A        #######################################################
 153 T        ##########################################################
 154 A        ##############################################################
 155 C        ########################################################
 156 G        ########################################
 157 A        ##################################
 158 C        #################################
 159 T        ##########################
 160 C        #########################
 161 A        ######################
 162 C        #####################
 163 T        ###############
 164 A        ##########
 165 T        ##########
 166 A        #########
 167 G        ########
 168 G        #####
 169 G        ######
 170 C        #####
 171 G        ######
 172 A        ####
 173 A        #####
 174 T        #####
 175 T        ####
 176 G        #####
 177 G        #####
 178 G        #####
 179 C        #####
 180 C        #####
 181 C        #####
 182 G        ######
 183 A        #######
 184 C        ########
 185 G        #########
 186 T        ##########
 187 C        ##########
 188 G        #################
 189 C        #################
 190 A        ####################
 191 T        #######################
 192 G        ############################################
 193 C        ####################################################
 194 T        ###################################################
 195 C        #######################################################################
 196 C        ##################################################################
 197 T        ###################################################################################################
 198 C        ###################################################################################################
 199 T        #################################################################################
 200 A        ################################################################################
 201 G        ################################################################################
 202 A        ###########################################################
 203 C        ###########################################
 204 T        ###############################
 205 C        ############################
 206 G        #######################
 207 A        #############
 208 G        ############
 209 G        ##########
 210 A        #######
 211 A        ######
 212 T        ####
 213 T        ###
 214 C        ####
 215 G        #####
 216 G        #####
 217 T        ###
 218 A        ####
 219 C        ###
 220 C        ####
 221 C        ####
 222 C        ###
 223 C        ###
 224 G        ####
 225 T        ###
 226 A        ###
 227 T        ###
 228 C        ###
 229 A        ####
 230 C        ###
 231 C        ###
 232 G        ####
 233 G        #####
 234 C        ####
 235 G        #####
 236 G        ####
 237 T        ###
 238 G        #####
 239 A        ####
 240 T        ###
 241 A        #####
 242 C        ####
 243 G        #####
 244 A        ####
 245 A        ####
 246 T        ####
 247 T        ####
 248 C        #####
 249 G        ######
 250 T        ####
 251 A        #####
 252 T        #####
 253 C        #####
 254 C        #####
 255 C        ######
 256 T        #####
 257 T        #####
 258 C        ######
 259 G        #######
 260 G        ######
 261 T        #####
 262 G        #######
 263 A        #####
 264 T        #####
 265 A        ######
 266 C        #######
 267 G        #######
 268 C        ######
 269 T        #####
 270 A        #####
 271 G        ######
 272 G        #####
 273 G        ######
 274 G        ######
 275 T        ####
 276 T        ##
 277 C        ###
 278 G        #########
 279 T        #####
 280 A        ######


Length from 3'-end
 249 T        #
 248 G        
 247 T        ####
 246 G        #
 245 C        #
 244 T        #
 243 G        #
 242 C        #
 241 A        #
 240 A        #
 239 G        #
 238 G        #
 237 C        #
 236 G        #
 235 A        #
 234 T        #
 233 T        #
 232 A        #
 231 A        #
 230 G        ##
 229 T        #
 228 T        #
 227 G        #
 226 G        #
 225 G        #
 224 T        #
 223 A        #
 222 A        #
 221 C        ##
 220 G        #
 219 C        #
 218 C        #
 217 A        #
 216 G        ##
 215 G        ##
 214 G        ##
 213 T        #
 212 T        #
 211 T        #
 210 T        #
 209 C        #
 208 C        #
 207 C        #
 206 A        ##
 205 G        ##
 204 T        ##
 203 C        ##
 202 A        ##
 201 C        #
 200 G        #
 199 A        
 198 C        #
 197 G        ##
 196 T        #
 195 T        ######
 194 G        ###################
 193 T        #
 192 A        ##
 191 A        ####
 190 A        ###
 189 A        ###
 188 C        ###
 187 G        ######
 186 A        ####
 185 C        #####
 184 G        ######
 183 G        #########
 182 C        ######
 181 C        ########
 180 A        ##########
 179 G        ###########
 178 T        ############
 177 G        ##################
 176 A        ####################
 175 A        ##########################
 174 T        #################################
 173 T        #####################################
 172 G        ############################################
 171 T        ######################################################
 170 A        ##########################################################
 169 A        #######################################################
 168 T        ##########################################################
 167 A        ##############################################################
 166 C        ########################################################
 165 G        ########################################
 164 A        ##################################
 163 C        #################################
 162 T        ##########################
 161 C        #########################
 160 A        ######################
 159 C        #####################
 158 T        ###############
 157 A        ##########
 156 T        ##########
 155 A        #########
 154 G        ########
 153 G        #####
 152 G        ######
 151 C        #####
 150 G        ######
 149 A        ####
 148 A        #####
 147 T        #####
 146 T        ####
 145 G        #####
 144 G        #####
 143 G        #####
 142 C        #####
 141 C        #####
 140 C        #####
 139 G        ######
 138 A        #######
 137 C        ########
 136 G        #########
 135 T        ##########
 134 C        ##########
 133 G        #################
 132 C        #################
 131 A        ####################
 130 T        #######################
 129 G        ############################################
 128 C        ####################################################
 127 T        ###################################################
 126 C        #######################################################################
 125 C        ##################################################################
 124 T        ###################################################################################################
 123 C        ###################################################################################################
 122 T        #################################################################################
 121 A        ################################################################################
 120 G        ################################################################################
 119 A        ###########################################################
 118 C        ###########################################
 117 T        ###############################
 116 C        ############################
 115 G        #######################
 114 A        #############
 113 G        ############
 112 G        ##########
 111 A        #######
 110 A        ######
 109 T        ####
 108 T        ###
 107 C        ####
 106 G        #####
 105 G        #####
 104 T        ###
 103 A        ####
 102 C        ###
 101 C        ####
 100 C        ####
 99 C         ###
 98 C         ###
 97 G         ####
 96 T         ###
 95 A         ###
 94 T         ###
 93 C         ###
 92 A         ####
 91 C         ###
 90 C         ###
 89 G         ####
 88 G         #####
 87 C         ####
 86 G         #####
 85 G         ####
 84 T         ###
 83 G         #####
 82 A         ####
 81 T         ###
 80 A         #####
 79 C         ####
 78 G         #####
 77 A         ####
 76 A         ####
 75 T         ####
 74 T         ####
 73 C         #####
 72 G         ######
 71 T         ####
 70 A         #####
 69 T         #####
 68 C         #####
 67 C         #####
 66 C         ######
 65 T         #####
 64 T         #####
 63 C         ######
 62 G         #######
 61 G         ######
 60 T         #####
 59 G         #######
 58 A         #####
 57 T         #####
 56 A         ######
 55 C         #######
 54 G         #######
 53 C         ######
 52 T         #####
 51 A         #####
 50 G         ######
 49 G         #####
 48 G         ######
 47 G         ######
 46 T         ####
 45 T         ##
 44 C         ###
 43 G         #########
 42 T         #####
 41 A         ######


Length from nick
-125 T        #
-124 G        
-123 T        ####
-122 G        #
-121 C        #
-120 T        #
-119 G        #
-118 C        #
-117 A        #
-116 A        #
-115 G        #
-114 G        #
-113 C        #
-112 G        #
-111 A        #
-110 T        #
-109 T        #
-108 A        #
-107 A        #
-106 G        ##
-105 T        #
-104 T        #
-103 G        #
-102 G        #
-101 G        #
-100 T        #
-99 A         #
-98 A         #
-97 C         ##
-96 G         #
-95 C         #
-94 C         #
-93 A         #
-92 G         ##
-91 G         ##
-90 G         ##
-89 T         #
-88 T         #
-87 T         #
-86 T         #
-85 C         #
-84 C         #
-83 C         #
-82 A         ##
-81 G         ##
-80 T         ##
-79 C         ##
-78 A         ##
-77 C         #
-76 G         #
-75 A         
-74 C         #
-73 G         ##
-72 T         #
-71 T         ######
-70 G         ###################
-69 T         #
-68 A         ##
-67 A         ####
-66 A         ###
-65 A         ###
-64 C         ###
-63 G         ######
-62 A         ####
-61 C         #####
-60 G         ######
-59 G         #########
-58 C         ######
-57 C         ########
-56 A         ##########
-55 G         ###########
-54 T         ############
-53 G         ##################
-52 A         ####################
-51 A         ##########################
-50 T         #################################
-49 T         #####################################
-48 G         ############################################
-47 T         ######################################################
-46 A         ##########################################################
-45 A         #######################################################
-44 T         ##########################################################
-43 A         ##############################################################
-42 C         ########################################################
-41 G         ########################################
-40 A         ##################################
-39 C         #################################
-38 T         ##########################
-37 C         #########################
-36 A         ######################
-35 C         #####################
-34 T         ###############
-33 A         ##########
-32 T         ##########
-31 A         #########
-30 G         ########
-29 G         #####
-28 G         ######
-27 C         #####
-26 G         ######
-25 A         ####
-24 A         #####
-23 T         #####
-22 T         ####
-21 G         #####
-20 G         #####
-19 G         #####
-18 C         #####
-17 C         #####
-16 C         #####
-15 G         ######
-14 A         #######
-13 C         ########
-12 G         #########
-11 T         ##########
-10 C         ##########
-9 G          #################
-8 C          #################
-7 A          ####################
-6 T          #######################
-5 G          ############################################
-4 C          ####################################################
-3 T          ###################################################
-2 C          #######################################################################
-1 C          ##################################################################
 1 T          ###################################################################################################
 2 C          ###################################################################################################
 3 T          #################################################################################
 4 A          ################################################################################
 5 G          ################################################################################
 6 A          ###########################################################
 7 C          ###########################################
 8 T          ###############################
 9 C          ############################
 10 G         #######################
 11 A         #############
 12 G         ############
 13 G         ##########
 14 A         #######
 15 A         ######
 16 T         ####
 17 T         ###
 18 C         ####
 19 G         #####
 20 G         #####
 21 T         ###
 22 A         ####
 23 C         ###
 24 C         ####
 25 C         ####
 26 C         ###
 27 C         ###
 28 G         ####
 29 T         ###
 30 A         ###
 31 T         ###
 32 C         ###
 33 A         ####
 34 C         ###
 35 C         ###
 36 G         ####
 37 G         #####
 38 C         ####
 39 G         #####
 40 G         ####
 41 T         ###
 42 G         #####
 43 A         ####
 44 T         ###
 45 A         #####
 46 C         ####
 47 G         #####
 48 A         ####
 49 A         ####
 50 T         ####
 51 T         ####
 52 C         #####
 53 G         ######
 54 T         ####
 55 A         #####
 56 T         #####
 57 C         #####
 58 C         #####
 59 C         ######
 60 T         #####
 61 T         #####
 62 C         ######
 63 G         #######
 64 G         ######
 65 T         #####
 66 G         #######
 67 A         #####
 68 T         #####
 69 A         ######
 70 C         #######
 71 G         #######
 72 C         ######
 73 T         #####
 74 A         #####
 75 G         ######
 76 G         #####
 77 G         ######
 78 G         ######
 79 T         ####
 80 T         ##
 81 C         ###
 82 G         #########
 83 T         #####
 84 A         ######


Name of gel and number of scan = No57 def.098
Name of sequence = Clon No 1647
Number of lanes =  15 
Lane for analysis =  8 
Number of analysing nucleotide =  209 
First analysing nucleotide =  72 
3'-nucleotide before nik =  151 
5'-GGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTGTAATACGACTCACTATAGGGCGAATTGGGCCCGACGTCGCATGCTCCTCTAGACTCGAGGAATTCGGTACCCCCGTATCACCGGCGGTGATACGAATTCGTATCCCTTCGGTGATACGCTAGGGGTTCGTATCACCGCCGGTGATACGCGAAATCGCGATAAGCTTGGATC0
Length of fragment =  320   P(K)=P(K)/100

 72 T 379 
 73 G 18 
 74 T 1747 
 75 G 406 
 76 C 432 
 77 T 462 
 78 G 495 
 79 C 520 
 80 A 464 
 81 A 474 
 82 G 536 
 83 G 635 
 84 C 631 
 85 G 517 
 86 A 460 
 87 T 407 
 88 T 390 
 89 A 377 
 90 A 628 
 91 G 747 
 92 T 699 
 93 T 621 
 94 G 581 
 95 G 606 
 96 G 640 
 97 T 650 
 98 A 668 
 99 A 650 
 100 C 740 
 101 G 644 
 102 C 531 
 103 C 597 
 104 A 680 
 105 G 778 
 106 G 832 
 107 G 735 
 108 T 702 
 109 T 616 
 110 T 641 
 111 T 676 
 112 C 693 
 113 C 688 
 114 C 712 
 115 A 834 
 116 G 827 
 117 T 837 
 118 C 785 
 119 A 754 
 120 C 728 
 121 G 508 
 122 A 189 
 123 C 436 
 124 G 872 
 125 T 650 
 126 T 2210 
 127 G 6945 
 128 T 692 
 129 A 907 
 130 A 1530 
 131 A 1278 
 132 A 1240 
 133 C 1387 
 134 G 2319 
 135 A 1560 
 136 C 1813 
 137 G 2423 
 138 G 3256 
 139 C 2391 
 140 C 2901 
 141 A 3616 
 142 G 4310 
 143 T 4312 
 144 G 6654 
 145 A 7409 
 146 A 9645 
 147 T 12052 
 148 T 13296 
 149 G 16038 
 150 T 19430 
 151 A 20872 
 152 A 20015 
 153 T 21039 
 154 A 22223 
 155 C 20176 
 156 G 14524 
 157 A 12279 
 158 C 11937 
 159 T 9398 
 160 C 9002 
 161 A 8060 
 162 C 7854 
 163 T 5575 
 164 A 3806 
 165 T 3707 
 166 A 3439 
 167 G 3004 
 168 G 1974 
 169 G 2286 
 170 C 2092 
 171 G 2239 
 172 A 1706 
 173 A 1839 
 174 T 1930 
 175 T 1629 
 176 G 1932 
 177 G 1968 
 178 G 2006 
 179 C 1886 
 180 C 1860 
 181 C 2041 
 182 G 2471 
 183 A 2626 
 184 C 2958 
 185 G 3294 
 186 T 3620 
 187 C 3819 
 188 G 6257 
 189 C 6109 
 190 A 7176 
 191 T 8526 
 192 G 16050 
 193 C 18963 
 194 T 18417 
 195 C 25755 
 196 C 23735 
 197 T 35565 
 198 C 35770 
 199 T 29241 
 200 A 28933 
 201 G 28841 
 202 A 21310 
 203 C 15644 
 204 T 11221 
 205 C 10095 
 206 G 8441 
 207 A 4929 
 208 G 4569 
 209 G 3705 
 210 A 2557 
 211 A 2195 
 212 T 1652 
 213 T 1369 
 214 C 1496 
 215 G 1949 
 216 G 1943 
 217 T 1267 
 218 A 1609 
 219 C 1373 
 220 C 1508 
 221 C 1450 
 222 C 1289 
 223 C 1229 
 224 G 1787 
 225 T 1174 
 226 A 1447 
 227 T 1202 
 228 C 1202 
 229 A 1504 
 230 C 1285 
 231 C 1384 
 232 G 1721 
 233 G 1814 
 234 C 1516 
 235 G 1934 
 236 G 1794 
 237 T 1381 
 238 G 1969 
 239 A 1626 
 240 T 1424 
 241 A 1835 
 242 C 1556 
 243 G 1960 
 244 A 1583 
 245 A 1667 
 246 T 1455 
 247 T 1490 
 248 C 1826 
 249 G 2175 
 250 T 1792 
 251 A 1960 
 252 T 1839 
 253 C 1900 
 254 C 1985 
 255 C 2217 
 256 T 2084 
 257 T 2136 
 258 C 2415 
 259 G 2540 
 260 G 2495 
 261 T 2086 
 262 G 2550 
 263 A 2151 
 264 T 2057 
 265 A 2298 
 266 C 2545 
 267 G 2566 
 268 C 2277 
 269 T 2018 
 270 A 2029 
 271 G 2165 
 272 G 2073 
 273 G 2165 
 274 G 2192 
 275 T 1747 
 276 T 1014 
 277 C 1406 
 278 G 3348 
 279 T 1824 
 280 A 2429 

MAX = 35770   MIN = 18 

Length from 5'-end
 72 T         #
 73 G         
 74 T         ####
 75 G         #
 76 C         #
 77 T         #
 78 G         #
 79 C         #
 80 A         #
 81 A         #
 82 G         #
 83 G         #
 84 C         #
 85 G         #
 86 A         #
 87 T         #
 88 T         #
 89 A         #
 90 A         #
 91 G         ##
 92 T         #
 93 T         #
 94 G         #
 95 G         #
 96 G         #
 97 T         #
 98 A         #
 99 A         #
 100 C        ##
 101 G        #
 102 C        #
 103 C        #
 104 A        #
 105 G        ##
 106 G        ##
 107 G        ##
 108 T        #
 109 T        #
 110 T        #
 111 T        #
 112 C        #
 113 C        #
 114 C        #
 115 A        ##
 116 G        ##
 117 T        ##
 118 C        ##
 119 A        ##
 120 C        #
 121 G        #
 122 A        
 123 C        #
 124 G        ##
 125 T        #
 126 T        ######
 127 G        ###################
 128 T        #
 129 A        ##
 130 A        ####
 131 A        ###
 132 A        ###
 133 C        ###
 134 G        ######
 135 A        ####
 136 C        #####
 137 G        ######
 138 G        #########
 139 C        ######
 140 C        ########
 141 A        ##########
 142 G        ###########
 143 T        ############
 144 G        ##################
 145 A        ####################
 146 A        ##########################
 147 T        #################################
 148 T        #####################################
 149 G        ############################################
 150 T        ######################################################
 151 A        ##########################################################
 152 A        #######################################################
 153 T        ##########################################################
 154 A        ##############################################################
 155 C        ########################################################
 156 G        ########################################
 157 A        ##################################
 158 C        #################################
 159 T        ##########################
 160 C        #########################
 161 A        ######################
 162 C        #####################
 163 T        ###############
 164 A        ##########
 165 T        ##########
 166 A        #########
 167 G        ########
 168 G        #####
 169 G        ######
 170 C        #####
 171 G        ######
 172 A        ####
 173 A        #####
 174 T        #####
 175 T        ####
 176 G        #####
 177 G        #####
 178 G        #####
 179 C        #####
 180 C        #####
 181 C        #####
 182 G        ######
 183 A        #######
 184 C        ########
 185 G        #########
 186 T        ##########
 187 C        ##########
 188 G        #################
 189 C        #################
 190 A        ####################
 191 T        #######################
 192 G        ############################################
 193 C        ####################################################
 194 T        ###################################################
 195 C        #######################################################################
 196 C        ##################################################################
 197 T        ###################################################################################################
 198 C        ###################################################################################################
 199 T        #################################################################################
 200 A        ################################################################################
 201 G        ################################################################################
 202 A        ###########################################################
 203 C        ###########################################
 204 T        ###############################
 205 C        ############################
 206 G        #######################
 207 A        #############
 208 G        ############
 209 G        ##########
 210 A        #######
 211 A        ######
 212 T        ####
 213 T        ###
 214 C        ####
 215 G        #####
 216 G        #####
 217 T        ###
 218 A        ####
 219 C        ###
 220 C        ####
 221 C        ####
 222 C        ###
 223 C        ###
 224 G        ####
 225 T        ###
 226 A        ###
 227 T        ###
 228 C        ###
 229 A        ####
 230 C        ###
 231 C        ###
 232 G        ####
 233 G        #####
 234 C        ####
 235 G        #####
 236 G        ####
 237 T        ###
 238 G        #####
 239 A        ####
 240 T        ###
 241 A        #####
 242 C        ####
 243 G        #####
 244 A        ####
 245 A        ####
 246 T        ####
 247 T        ####
 248 C        #####
 249 G        ######
 250 T        ####
 251 A        #####
 252 T        #####
 253 C        #####
 254 C        #####
 255 C        ######
 256 T        #####
 257 T        #####
 258 C        ######
 259 G        #######
 260 G        ######
 261 T        #####
 262 G        #######
 263 A        #####
 264 T        #####
 265 A        ######
 266 C        #######
 267 G        #######
 268 C        ######
 269 T        #####
 270 A        #####
 271 G        ######
 272 G        #####
 273 G        ######
 274 G        ######
 275 T        ####
 276 T        ##
 277 C        ###
 278 G        #########
 279 T        #####
 280 A        ######


Length from 3'-end
 249 T        #
 248 G        
 247 T        ####
 246 G        #
 245 C        #
 244 T        #
 243 G        #
 242 C        #
 241 A        #
 240 A        #
 239 G        #
 238 G        #
 237 C        #
 236 G        #
 235 A        #
 234 T        #
 233 T        #
 232 A        #
 231 A        #
 230 G        ##
 229 T        #
 228 T        #
 227 G        #
 226 G        #
 225 G        #
 224 T        #
 223 A        #
 222 A        #
 221 C        ##
 220 G        #
 219 C        #
 218 C        #
 217 A        #
 216 G        ##
 215 G        ##
 214 G        ##
 213 T        #
 212 T        #
 211 T        #
 210 T        #
 209 C        #
 208 C        #
 207 C        #
 206 A        ##
 205 G        ##
 204 T        ##
 203 C        ##
 202 A        ##
 201 C        #
 200 G        #
 199 A        
 198 C        #
 197 G        ##
 196 T        #
 195 T        ######
 194 G        ###################
 193 T        #
 192 A        ##
 191 A        ####
 190 A        ###
 189 A        ###
 188 C        ###
 187 G        ######
 186 A        ####
 185 C        #####
 184 G        ######
 183 G        #########
 182 C        ######
 181 C        ########
 180 A        ##########
 179 G        ###########
 178 T        ############
 177 G        ##################
 176 A        ####################
 175 A        ##########################
 174 T        #################################
 173 T        #####################################
 172 G        ############################################
 171 T        ######################################################
 170 A        ##########################################################
 169 A        #######################################################
 168 T        ##########################################################
 167 A        ##############################################################
 166 C        ########################################################
 165 G        ########################################
 164 A        ##################################
 163 C        #################################
 162 T        ##########################
 161 C        #########################
 160 A        ######################
 159 C        #####################
 158 T        ###############
 157 A        ##########
 156 T        ##########
 155 A        #########
 154 G        ########
 153 G        #####
 152 G        ######
 151 C        #####
 150 G        ######
 149 A        ####
 148 A        #####
 147 T        #####
 146 T        ####
 145 G        #####
 144 G        #####
 143 G        #####
 142 C        #####
 141 C        #####
 140 C        #####
 139 G        ######
 138 A        #######
 137 C        ########
 136 G        #########
 135 T        ##########
 134 C        ##########
 133 G        #################
 132 C        #################
 131 A        ####################
 130 T        #######################
 129 G        ############################################
 128 C        ####################################################
 127 T        ###################################################
 126 C        #######################################################################
 125 C        ##################################################################
 124 T        ###################################################################################################
 123 C        ###################################################################################################
 122 T        #################################################################################
 121 A        ################################################################################
 120 G        ################################################################################
 119 A        ###########################################################
 118 C        ###########################################
 117 T        ###############################
 116 C        ############################
 115 G        #######################
 114 A        #############
 113 G        ############
 112 G        ##########
 111 A        #######
 110 A        ######
 109 T        ####
 108 T        ###
 107 C        ####
 106 G        #####
 105 G        #####
 104 T        ###
 103 A        ####
 102 C        ###
 101 C        ####
 100 C        ####
 99 C         ###
 98 C         ###
 97 G         ####
 96 T         ###
 95 A         ###
 94 T         ###
 93 C         ###
 92 A         ####
 91 C         ###
 90 C         ###
 89 G         ####
 88 G         #####
 87 C         ####
 86 G         #####
 85 G         ####
 84 T         ###
 83 G         #####
 82 A         ####
 81 T         ###
 80 A         #####
 79 C         ####
 78 G         #####
 77 A         ####
 76 A         ####
 75 T         ####
 74 T         ####
 73 C         #####
 72 G         ######
 71 T         ####
 70 A         #####
 69 T         #####
 68 C         #####
 67 C         #####
 66 C         ######
 65 T         #####
 64 T         #####
 63 C         ######
 62 G         #######
 61 G         ######
 60 T         #####
 59 G         #######
 58 A         #####
 57 T         #####
 56 A         ######
 55 C         #######
 54 G         #######
 53 C         ######
 52 T         #####
 51 A         #####
 50 G         ######
 49 G         #####
 48 G         ######
 47 G         ######
 46 T         ####
 45 T         ##
 44 C         ###
 43 G         #########
 42 T         #####
 41 A         ######


Length from nick
-80 T         #
-79 G         
-78 T         ####
-77 G         #
-76 C         #
-75 T         #
-74 G         #
-73 C         #
-72 A         #
-71 A         #
-70 G         #
-69 G         #
-68 C         #
-67 G         #
-66 A         #
-65 T         #
-64 T         #
-63 A         #
-62 A         #
-61 G         ##
-60 T         #
-59 T         #
-58 G         #
-57 G         #
-56 G         #
-55 T         #
-54 A         #
-53 A         #
-52 C         ##
-51 G         #
-50 C         #
-49 C         #
-48 A         #
-47 G         ##
-46 G         ##
-45 G         ##
-44 T         #
-43 T         #
-42 T         #
-41 T         #
-40 C         #
-39 C         #
-38 C         #
-37 A         ##
-36 G         ##
-35 T         ##
-34 C         ##
-33 A         ##
-32 C         #
-31 G         #
-30 A         
-29 C         #
-28 G         ##
-27 T         #
-26 T         ######
-25 G         ###################
-24 T         #
-23 A         ##
-22 A         ####
-21 A         ###
-20 A         ###
-19 C         ###
-18 G         ######
-17 A         ####
-16 C         #####
-15 G         ######
-14 G         #########
-13 C         ######
-12 C         ########
-11 A         ##########
-10 G         ###########
-9 T          ############
-8 G          ##################
-7 A          ####################
-6 A          ##########################
-5 T          #################################
-4 T          #####################################
-3 G          ############################################
-2 T          ######################################################
-1 A          ##########################################################
 1 A          #######################################################
 2 T          ##########################################################
 3 A          ##############################################################
 4 C          ########################################################
 5 G          ########################################
 6 A          ##################################
 7 C          #################################
 8 T          ##########################
 9 C          #########################
 10 A         ######################
 11 C         #####################
 12 T         ###############
 13 A         ##########
 14 T         ##########
 15 A         #########
 16 G         ########
 17 G         #####
 18 G         ######
 19 C         #####
 20 G         ######
 21 A         ####
 22 A         #####
 23 T         #####
 24 T         ####
 25 G         #####
 26 G         #####
 27 G         #####
 28 C         #####
 29 C         #####
 30 C         #####
 31 G         ######
 32 A         #######
 33 C         ########
 34 G         #########
 35 T         ##########
 36 C         ##########
 37 G         #################
 38 C         #################
 39 A         ####################
 40 T         #######################
 41 G         ############################################
 42 C         ####################################################
 43 T         ###################################################
 44 C         #######################################################################
 45 C         ##################################################################
 46 T         ###################################################################################################
 47 C         ###################################################################################################
 48 T         #################################################################################
 49 A         ################################################################################
 50 G         ################################################################################
 51 A         ###########################################################
 52 C         ###########################################
 53 T         ###############################
 54 C         ############################
 55 G         #######################
 56 A         #############
 57 G         ############
 58 G         ##########
 59 A         #######
 60 A         ######
 61 T         ####
 62 T         ###
 63 C         ####
 64 G         #####
 65 G         #####
 66 T         ###
 67 A         ####
 68 C         ###
 69 C         ####
 70 C         ####
 71 C         ###
 72 C         ###
 73 G         ####
 74 T         ###
 75 A         ###
 76 T         ###
 77 C         ###
 78 A         ####
 79 C         ###
 80 C         ###
 81 G         ####
 82 G         #####
 83 C         ####
 84 G         #####
 85 G         ####
 86 T         ###
 87 G         #####
 88 A         ####
 89 T         ###
 90 A         #####
 91 C         ####
 92 G         #####
 93 A         ####
 94 A         ####
 95 T         ####
 96 T         ####
 97 C         #####
 98 G         ######
 99 T         ####
 100 A        #####
 101 T        #####
 102 C        #####
 103 C        #####
 104 C        ######
 105 T        #####
 106 T        #####
 107 C        ######
 108 G        #######
 109 G        ######
 110 T        #####
 111 G        #######
 112 A        #####
 113 T        #####
 114 A        ######
 115 C        #######
 116 G        #######
 117 C        ######
 118 T        #####
 119 A        #####
 120 G        ######
 121 G        #####
 122 G        ######
 123 G        ######
 124 T        ####
 125 T        ##
 126 C        ###
 127 G        #########
 128 T        #####
 129 A        ######


Name of gel and number of scan = No57 def.095
Name of sequence = Clon No 1647
Number of lanes =  21 
Lane for analysis =  13 
Number of analysing nucleotide =  176 
First analysing nucleotide =  104 
3'-nucleotide before nik =  151 
5'-GGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTGTAATACGACTCACTATAGGGCGAATTGGGCCCGACGTCGCATGCTCCTCTAGACTCGAGGAATTCGGTACCCCCGTATCACCGGCGGTGATACGAATTCGTATCCCTTCGGTGATACGCTAGGGGTTCGTATCACCGCCGGTGATACGCGAAATCGCGATAAGCTTGGATC0
Length of fragment =  320   P(K)=P(K)/100

 104 A 592 
 105 G 569 
 106 G 785 
 107 G 629 
 108 T 769 
 109 T 1065 
 110 T 1055 
 111 T 763 
 112 C 843 
 113 C 1800 
 114 C 1122 
 115 A 631 
 116 G 1152 
 117 T 1133 
 118 C 1230 
 119 A 1088 
 120 C 1140 
 121 G 886 
 122 A 1323 
 123 C 1704 
 124 G 1360 
 125 T 1269 
 126 T 1194 
 127 G 938 
 128 T 1572 
 129 A 1661 
 130 A 2183 
 131 A 2150 
 132 A 2106 
 133 C 1387 
 134 G 2389 
 135 A 1892 
 136 C 6860 
 137 G 4779 
 138 G 4590 
 139 C 6271 
 140 C 7428 
 141 A 12794 
 142 G 20259 
 143 T 23257 
 144 G 29463 
 145 A 32552 
 146 A 39300 
 147 T 39982 
 148 T 39510 
 149 G 52025 
 150 T 44297 
 151 A 39521 
 152 A 28051 
 153 T 26769 
 154 A 16274 
 155 C 21255 
 156 G 16027 
 157 A 15672 
 158 C 13919 
 159 T 14080 
 160 C 13264 
 161 A 12612 
 162 C 10219 
 163 T 5642 
 164 A 5399 
 165 T 4899 
 166 A 5170 
 167 G 4248 
 168 G 4266 
 169 G 3345 
 170 C 3448 
 171 G 3060 
 172 A 2932 
 173 A 3331 
 174 T 2858 
 175 T 2948 
 176 G 3375 
 177 G 3007 
 178 G 2349 
 179 C 3255 
 180 C 3242 
 181 C 3767 
 182 G 5216 
 183 A 5791 
 184 C 5881 
 185 G 5721 
 186 T 10004 
 187 C 10099 
 188 G 11514 
 189 C 14088 
 190 A 34301 
 191 T 35228 
 192 G 37027 
 193 C 48332 
 194 T 43154 
 195 C 56393 
 196 C 26816 
 197 T 36374 
 198 C 54371 
 199 T 53520 
 200 A 51517 
 201 G 36327 
 202 A 38199 
 203 C 29185 
 204 T 31952 
 205 C 23378 
 206 G 9228 
 207 A 10037 
 208 G 7932 
 209 G 5956 
 210 A 3644 
 211 A 3484 
 212 T 2644 
 213 T 2686 
 214 C 3041 
 215 G 2905 
 216 G 2061 
 217 T 2830 
 218 A 2140 
 219 C 2459 
 220 C 2522 
 221 C 2085 
 222 C 1769 
 223 C 2882 
 224 G 2046 
 225 T 2111 
 226 A 1962 
 227 T 1790 
 228 C 2329 
 229 A 2142 
 230 C 2341 
 231 C 2739 
 232 G 2700 
 233 G 2705 
 234 C 2768 
 235 G 2959 
 236 G 2148 
 237 T 3071 
 238 G 2606 
 239 A 2374 
 240 T 2943 
 241 A 2596 
 242 C 3071 
 243 G 2462 
 244 A 2717 
 245 A 2576 
 246 T 2432 
 247 T 3372 
 248 C 3671 
 249 G 2993 
 250 T 3275 
 251 A 3071 
 252 T 3430 
 253 C 3680 
 254 C 3951 
 255 C 3990 
 256 T 2776 
 257 T 3352 
 258 C 0 
 259 G 9232 
 260 G 0 
 261 T 6418 
 262 G 4800 
 263 A 4168 
 264 T 3701 
 265 A 3580 
 266 C 5618 
 267 G 2618 
 268 C 4214 
 269 T 2807 
 270 A 3525 
 271 G 3358 
 272 G 3071 
 273 G 2961 
 274 G 3706 
 275 T 5066 
 276 T 3907 
 277 C 5450 
 278 G 2853 
 279 T 2770 

MAX = 56393   MIN = 0 

Length from 5'-end
 104 A        #
 105 G        #
 106 G        #
 107 G        #
 108 T        #
 109 T        #
 110 T        #
 111 T        #
 112 C        #
 113 C        ###
 114 C        #
 115 A        #
 116 G        ##
 117 T        ##
 118 C        ##
 119 A        #
 120 C        ##
 121 G        #
 122 A        ##
 123 C        ###
 124 G        ##
 125 T        ##
 126 T        ##
 127 G        #
 128 T        ##
 129 A        ##
 130 A        ###
 131 A        ###
 132 A        ###
 133 C        ##
 134 G        ####
 135 A        ###
 136 C        ############
 137 G        ########
 138 G        ########
 139 C        ###########
 140 C        #############
 141 A        ######################
 142 G        ###################################
 143 T        #########################################
 144 G        ####################################################
 145 A        #########################################################
 146 A        #####################################################################
 147 T        ######################################################################
 148 T        ######################################################################
 149 G        ############################################################################################
 150 T        ##############################################################################
 151 A        ######################################################################
 152 A        #################################################
 153 T        ###############################################
 154 A        ############################
 155 C        #####################################
 156 G        ############################
 157 A        ###########################
 158 C        ########################
 159 T        ########################
 160 C        #######################
 161 A        ######################
 162 C        ##################
 163 T        ##########
 164 A        #########
 165 T        ########
 166 A        #########
 167 G        #######
 168 G        #######
 169 G        #####
 170 C        ######
 171 G        #####
 172 A        #####
 173 A        #####
 174 T        #####
 175 T        #####
 176 G        #####
 177 G        #####
 178 G        ####
 179 C        #####
 180 C        #####
 181 C        ######
 182 G        #########
 183 A        ##########
 184 C        ##########
 185 G        ##########
 186 T        #################
 187 C        #################
 188 G        ####################
 189 C        ########################
 190 A        ############################################################
 191 T        ##############################################################
 192 G        #################################################################
 193 C        #####################################################################################
 194 T        ############################################################################
 195 C        ####################################################################################################
 196 C        ###############################################
 197 T        ################################################################
 198 C        ################################################################################################
 199 T        ##############################################################################################
 200 A        ###########################################################################################
 201 G        ################################################################
 202 A        ###################################################################
 203 C        ###################################################
 204 T        ########################################################
 205 C        #########################################
 206 G        ################
 207 A        #################
 208 G        ##############
 209 G        ##########
 210 A        ######
 211 A        ######
 212 T        ####
 213 T        ####
 214 C        #####
 215 G        #####
 216 G        ###
 217 T        #####
 218 A        ###
 219 C        ####
 220 C        ####
 221 C        ###
 222 C        ###
 223 C        #####
 224 G        ###
 225 T        ###
 226 A        ###
 227 T        ###
 228 C        ####
 229 A        ###
 230 C        ####
 231 C        ####
 232 G        ####
 233 G        ####
 234 C        ####
 235 G        #####
 236 G        ###
 237 T        #####
 238 G        ####
 239 A        ####
 240 T        #####
 241 A        ####
 242 C        #####
 243 G        ####
 244 A        ####
 245 A        ####
 246 T        ####
 247 T        #####
 248 C        ######
 249 G        #####
 250 T        #####
 251 A        #####
 252 T        ######
 253 C        ######
 254 C        #######
 255 C        #######
 256 T        ####
 257 T        #####
 258 C        
 259 G        ################
 260 G        
 261 T        ###########
 262 G        ########
 263 A        #######
 264 T        ######
 265 A        ######
 266 C        #########
 267 G        ####
 268 C        #######
 269 T        ####
 270 A        ######
 271 G        #####
 272 G        #####
 273 G        #####
 274 G        ######
 275 T        ########
 276 T        ######
 277 C        #########
 278 G        #####
 279 T        ####


Length from 3'-end
 217 A        #
 216 G        #
 215 G        #
 214 G        #
 213 T        #
 212 T        #
 211 T        #
 210 T        #
 209 C        #
 208 C        ###
 207 C        #
 206 A        #
 205 G        ##
 204 T        ##
 203 C        ##
 202 A        #
 201 C        ##
 200 G        #
 199 A        ##
 198 C        ###
 197 G        ##
 196 T        ##
 195 T        ##
 194 G        #
 193 T        ##
 192 A        ##
 191 A        ###
 190 A        ###
 189 A        ###
 188 C        ##
 187 G        ####
 186 A        ###
 185 C        ############
 184 G        ########
 183 G        ########
 182 C        ###########
 181 C        #############
 180 A        ######################
 179 G        ###################################
 178 T        #########################################
 177 G        ####################################################
 176 A        #########################################################
 175 A        #####################################################################
 174 T        ######################################################################
 173 T        ######################################################################
 172 G        ############################################################################################
 171 T        ##############################################################################
 170 A        ######################################################################
 169 A        #################################################
 168 T        ###############################################
 167 A        ############################
 166 C        #####################################
 165 G        ############################
 164 A        ###########################
 163 C        ########################
 162 T        ########################
 161 C        #######################
 160 A        ######################
 159 C        ##################
 158 T        ##########
 157 A        #########
 156 T        ########
 155 A        #########
 154 G        #######
 153 G        #######
 152 G        #####
 151 C        ######
 150 G        #####
 149 A        #####
 148 A        #####
 147 T        #####
 146 T        #####
 145 G        #####
 144 G        #####
 143 G        ####
 142 C        #####
 141 C        #####
 140 C        ######
 139 G        #########
 138 A        ##########
 137 C        ##########
 136 G        ##########
 135 T        #################
 134 C        #################
 133 G        ####################
 132 C        ########################
 131 A        ############################################################
 130 T        ##############################################################
 129 G        #################################################################
 128 C        #####################################################################################
 127 T        ############################################################################
 126 C        ####################################################################################################
 125 C        ###############################################
 124 T        ################################################################
 123 C        ################################################################################################
 122 T        ##############################################################################################
 121 A        ###########################################################################################
 120 G        ################################################################
 119 A        ###################################################################
 118 C        ###################################################
 117 T        ########################################################
 116 C        #########################################
 115 G        ################
 114 A        #################
 113 G        ##############
 112 G        ##########
 111 A        ######
 110 A        ######
 109 T        ####
 108 T        ####
 107 C        #####
 106 G        #####
 105 G        ###
 104 T        #####
 103 A        ###
 102 C        ####
 101 C        ####
 100 C        ###
 99 C         ###
 98 C         #####
 97 G         ###
 96 T         ###
 95 A         ###
 94 T         ###
 93 C         ####
 92 A         ###
 91 C         ####
 90 C         ####
 89 G         ####
 88 G         ####
 87 C         ####
 86 G         #####
 85 G         ###
 84 T         #####
 83 G         ####
 82 A         ####
 81 T         #####
 80 A         ####
 79 C         #####
 78 G         ####
 77 A         ####
 76 A         ####
 75 T         ####
 74 T         #####
 73 C         ######
 72 G         #####
 71 T         #####
 70 A         #####
 69 T         ######
 68 C         ######
 67 C         #######
 66 C         #######
 65 T         ####
 64 T         #####
 63 C         
 62 G         ################
 61 G         
 60 T         ###########
 59 G         ########
 58 A         #######
 57 T         ######
 56 A         ######
 55 C         #########
 54 G         ####
 53 C         #######
 52 T         ####
 51 A         ######
 50 G         #####
 49 G         #####
 48 G         #####
 47 G         ######
 46 T         ########
 45 T         ######
 44 C         #########
 43 G         #####
 42 T         ####


Length from nick
-48 A         #
-47 G         #
-46 G         #
-45 G         #
-44 T         #
-43 T         #
-42 T         #
-41 T         #
-40 C         #
-39 C         ###
-38 C         #
-37 A         #
-36 G         ##
-35 T         ##
-34 C         ##
-33 A         #
-32 C         ##
-31 G         #
-30 A         ##
-29 C         ###
-28 G         ##
-27 T         ##
-26 T         ##
-25 G         #
-24 T         ##
-23 A         ##
-22 A         ###
-21 A         ###
-20 A         ###
-19 C         ##
-18 G         ####
-17 A         ###
-16 C         ############
-15 G         ########
-14 G         ########
-13 C         ###########
-12 C         #############
-11 A         ######################
-10 G         ###################################
-9 T          #########################################
-8 G          ####################################################
-7 A          #########################################################
-6 A          #####################################################################
-5 T          ######################################################################
-4 T          ######################################################################
-3 G          ############################################################################################
-2 T          ##############################################################################
-1 A          ######################################################################
 1 A          #################################################
 2 T          ###############################################
 3 A          ############################
 4 C          #####################################
 5 G          ############################
 6 A          ###########################
 7 C          ########################
 8 T          ########################
 9 C          #######################
 10 A         ######################
 11 C         ##################
 12 T         ##########
 13 A         #########
 14 T         ########
 15 A         #########
 16 G         #######
 17 G         #######
 18 G         #####
 19 C         ######
 20 G         #####
 21 A         #####
 22 A         #####
 23 T         #####
 24 T         #####
 25 G         #####
 26 G         #####
 27 G         ####
 28 C         #####
 29 C         #####
 30 C         ######
 31 G         #########
 32 A         ##########
 33 C         ##########
 34 G         ##########
 35 T         #################
 36 C         #################
 37 G         ####################
 38 C         ########################
 39 A         ############################################################
 40 T         ##############################################################
 41 G         #################################################################
 42 C         #####################################################################################
 43 T         ############################################################################
 44 C         ####################################################################################################
 45 C         ###############################################
 46 T         ################################################################
 47 C         ################################################################################################
 48 T         ##############################################################################################
 49 A         ###########################################################################################
 50 G         ################################################################
 51 A         ###################################################################
 52 C         ###################################################
 53 T         ########################################################
 54 C         #########################################
 55 G         ################
 56 A         #################
 57 G         ##############
 58 G         ##########
 59 A         ######
 60 A         ######
 61 T         ####
 62 T         ####
 63 C         #####
 64 G         #####
 65 G         ###
 66 T         #####
 67 A         ###
 68 C         ####
 69 C         ####
 70 C         ###
 71 C         ###
 72 C         #####
 73 G         ###
 74 T         ###
 75 A         ###
 76 T         ###
 77 C         ####
 78 A         ###
 79 C         ####
 80 C         ####
 81 G         ####
 82 G         ####
 83 C         ####
 84 G         #####
 85 G         ###
 86 T         #####
 87 G         ####
 88 A         ####
 89 T         #####
 90 A         ####
 91 C         #####
 92 G         ####
 93 A         ####
 94 A         ####
 95 T         ####
 96 T         #####
 97 C         ######
 98 G         #####
 99 T         #####
 100 A        #####
 101 T        ######
 102 C        ######
 103 C        #######
 104 C        #######
 105 T        ####
 106 T        #####
 107 C        
 108 G        ################
 109 G        
 110 T        ###########
 111 G        ########
 112 A        #######
 113 T        ######
 114 A        ######
 115 C        #########
 116 G        ####
 117 C        #######
 118 T        ####
 119 A        ######
 120 G        #####
 121 G        #####
 122 G        #####
 123 G        ######
 124 T        ########
 125 T        ######
 126 C        #########
 127 G        #####
 128 T        ####


Name of gel and number of scan = No57 def.095
Name of sequence = Clon No 1647
Number of lanes =  21 
Lane for analysis =  13 
Number of analysing nucleotide =  176 
First analysing nucleotide =  104 
3'-nucleotide before nik =  196 
5'-GGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTGTAATACGACTCACTATAGGGCGAATTGGGCCCGACGTCGCATGCTCCTCTAGACTCGAGGAATTCGGTACCCCCGTATCACCGGCGGTGATACGAATTCGTATCCCTTCGGTGATACGCTAGGGGTTCGTATCACCGCCGGTGATACGCGAAATCGCGATAAGCTTGGATC0
Length of fragment =  320   P(K)=P(K)/100

 104 A 592 
 105 G 569 
 106 G 785 
 107 G 629 
 108 T 769 
 109 T 1065 
 110 T 1055 
 111 T 763 
 112 C 843 
 113 C 1800 
 114 C 1122 
 115 A 631 
 116 G 1152 
 117 T 1133 
 118 C 1230 
 119 A 1088 
 120 C 1140 
 121 G 886 
 122 A 1323 
 123 C 1704 
 124 G 1360 
 125 T 1269 
 126 T 1194 
 127 G 938 
 128 T 1572 
 129 A 1661 
 130 A 2183 
 131 A 2150 
 132 A 2106 
 133 C 1387 
 134 G 2389 
 135 A 1892 
 136 C 6860 
 137 G 4779 
 138 G 4590 
 139 C 6271 
 140 C 7428 
 141 A 12794 
 142 G 20259 
 143 T 23257 
 144 G 29463 
 145 A 32552 
 146 A 39300 
 147 T 39982 
 148 T 39510 
 149 G 52025 
 150 T 44297 
 151 A 39521 
 152 A 28051 
 153 T 26769 
 154 A 16274 
 155 C 21255 
 156 G 16027 
 157 A 15672 
 158 C 13919 
 159 T 14080 
 160 C 13264 
 161 A 12612 
 162 C 10219 
 163 T 5642 
 164 A 5399 
 165 T 4899 
 166 A 5170 
 167 G 4248 
 168 G 4266 
 169 G 3345 
 170 C 3448 
 171 G 3060 
 172 A 2932 
 173 A 3331 
 174 T 2858 
 175 T 2948 
 176 G 3375 
 177 G 3007 
 178 G 2349 
 179 C 3255 
 180 C 3242 
 181 C 3767 
 182 G 5216 
 183 A 5791 
 184 C 5881 
 185 G 5721 
 186 T 10004 
 187 C 10099 
 188 G 11514 
 189 C 14088 
 190 A 34301 
 191 T 35228 
 192 G 37027 
 193 C 48332 
 194 T 43154 
 195 C 56393 
 196 C 26816 
 197 T 36374 
 198 C 54371 
 199 T 53520 
 200 A 51517 
 201 G 36327 
 202 A 38199 
 203 C 29185 
 204 T 31952 
 205 C 23378 
 206 G 9228 
 207 A 10037 
 208 G 7932 
 209 G 5956 
 210 A 3644 
 211 A 3484 
 212 T 2644 
 213 T 2686 
 214 C 3041 
 215 G 2905 
 216 G 2061 
 217 T 2830 
 218 A 2140 
 219 C 2459 
 220 C 2522 
 221 C 2085 
 222 C 1769 
 223 C 2882 
 224 G 2046 
 225 T 2111 
 226 A 1962 
 227 T 1790 
 228 C 2329 
 229 A 2142 
 230 C 2341 
 231 C 2739 
 232 G 2700 
 233 G 2705 
 234 C 2768 
 235 G 2959 
 236 G 2148 
 237 T 3071 
 238 G 2606 
 239 A 2374 
 240 T 2943 
 241 A 2596 
 242 C 3071 
 243 G 2462 
 244 A 2717 
 245 A 2576 
 246 T 2432 
 247 T 3372 
 248 C 3671 
 249 G 2993 
 250 T 3275 
 251 A 3071 
 252 T 3430 
 253 C 3680 
 254 C 3951 
 255 C 3990 
 256 T 2776 
 257 T 3352 
 258 C 0 
 259 G 9232 
 260 G 0 
 261 T 6418 
 262 G 4800 
 263 A 4168 
 264 T 3701 
 265 A 3580 
 266 C 5618 
 267 G 2618 
 268 C 4214 
 269 T 2807 
 270 A 3525 
 271 G 3358 
 272 G 3071 
 273 G 2961 
 274 G 3706 
 275 T 5066 
 276 T 3907 
 277 C 5450 
 278 G 2853 
 279 T 2770 

MAX = 56393   MIN = 0 

Length from 5'-end
 104 A        #
 105 G        #
 106 G        #
 107 G        #
 108 T        #
 109 T        #
 110 T        #
 111 T        #
 112 C        #
 113 C        ###
 114 C        #
 115 A        #
 116 G        ##
 117 T        ##
 118 C        ##
 119 A        #
 120 C        ##
 121 G        #
 122 A        ##
 123 C        ###
 124 G        ##
 125 T        ##
 126 T        ##
 127 G        #
 128 T        ##
 129 A        ##
 130 A        ###
 131 A        ###
 132 A        ###
 133 C        ##
 134 G        ####
 135 A        ###
 136 C        ############
 137 G        ########
 138 G        ########
 139 C        ###########
 140 C        #############
 141 A        ######################
 142 G        ###################################
 143 T        #########################################
 144 G        ####################################################
 145 A        #########################################################
 146 A        #####################################################################
 147 T        ######################################################################
 148 T        ######################################################################
 149 G        ############################################################################################
 150 T        ##############################################################################
 151 A        ######################################################################
 152 A        #################################################
 153 T        ###############################################
 154 A        ############################
 155 C        #####################################
 156 G        ############################
 157 A        ###########################
 158 C        ########################
 159 T        ########################
 160 C        #######################
 161 A        ######################
 162 C        ##################
 163 T        ##########
 164 A        #########
 165 T        ########
 166 A        #########
 167 G        #######
 168 G        #######
 169 G        #####
 170 C        ######
 171 G        #####
 172 A        #####
 173 A        #####
 174 T        #####
 175 T        #####
 176 G        #####
 177 G        #####
 178 G        ####
 179 C        #####
 180 C        #####
 181 C        ######
 182 G        #########
 183 A        ##########
 184 C        ##########
 185 G        ##########
 186 T        #################
 187 C        #################
 188 G        ####################
 189 C        ########################
 190 A        ############################################################
 191 T        ##############################################################
 192 G        #################################################################
 193 C        #####################################################################################
 194 T        ############################################################################
 195 C        ####################################################################################################
 196 C        ###############################################
 197 T        ################################################################
 198 C        ################################################################################################
 199 T        ##############################################################################################
 200 A        ###########################################################################################
 201 G        ################################################################
 202 A        ###################################################################
 203 C        ###################################################
 204 T        ########################################################
 205 C        #########################################
 206 G        ################
 207 A        #################
 208 G        ##############
 209 G        ##########
 210 A        ######
 211 A        ######
 212 T        ####
 213 T        ####
 214 C        #####
 215 G        #####
 216 G        ###
 217 T        #####
 218 A        ###
 219 C        ####
 220 C        ####
 221 C        ###
 222 C        ###
 223 C        #####
 224 G        ###
 225 T        ###
 226 A        ###
 227 T        ###
 228 C        ####
 229 A        ###
 230 C        ####
 231 C        ####
 232 G        ####
 233 G        ####
 234 C        ####
 235 G        #####
 236 G        ###
 237 T        #####
 238 G        ####
 239 A        ####
 240 T        #####
 241 A        ####
 242 C        #####
 243 G        ####
 244 A        ####
 245 A        ####
 246 T        ####
 247 T        #####
 248 C        ######
 249 G        #####
 250 T        #####
 251 A        #####
 252 T        ######
 253 C        ######
 254 C        #######
 255 C        #######
 256 T        ####
 257 T        #####
 258 C        
 259 G        ################
 260 G        
 261 T        ###########
 262 G        ########
 263 A        #######
 264 T        ######
 265 A        ######
 266 C        #########
 267 G        ####
 268 C        #######
 269 T        ####
 270 A        ######
 271 G        #####
 272 G        #####
 273 G        #####
 274 G        ######
 275 T        ########
 276 T        ######
 277 C        #########
 278 G        #####
 279 T        ####


Length from 3'-end
 217 A        #
 216 G        #
 215 G        #
 214 G        #
 213 T        #
 212 T        #
 211 T        #
 210 T        #
 209 C        #
 208 C        ###
 207 C        #
 206 A        #
 205 G        ##
 204 T        ##
 203 C        ##
 202 A        #
 201 C        ##
 200 G        #
 199 A        ##
 198 C        ###
 197 G        ##
 196 T        ##
 195 T        ##
 194 G        #
 193 T        ##
 192 A        ##
 191 A        ###
 190 A        ###
 189 A        ###
 188 C        ##
 187 G        ####
 186 A        ###
 185 C        ############
 184 G        ########
 183 G        ########
 182 C        ###########
 181 C        #############
 180 A        ######################
 179 G        ###################################
 178 T        #########################################
 177 G        ####################################################
 176 A        #########################################################
 175 A        #####################################################################
 174 T        ######################################################################
 173 T        ######################################################################
 172 G        ############################################################################################
 171 T        ##############################################################################
 170 A        ######################################################################
 169 A        #################################################
 168 T        ###############################################
 167 A        ############################
 166 C        #####################################
 165 G        ############################
 164 A        ###########################
 163 C        ########################
 162 T        ########################
 161 C        #######################
 160 A        ######################
 159 C        ##################
 158 T        ##########
 157 A        #########
 156 T        ########
 155 A        #########
 154 G        #######
 153 G        #######
 152 G        #####
 151 C        ######
 150 G        #####
 149 A        #####
 148 A        #####
 147 T        #####
 146 T        #####
 145 G        #####
 144 G        #####
 143 G        ####
 142 C        #####
 141 C        #####
 140 C        ######
 139 G        #########
 138 A        ##########
 137 C        ##########
 136 G        ##########
 135 T        #################
 134 C        #################
 133 G        ####################
 132 C        ########################
 131 A        ############################################################
 130 T        ##############################################################
 129 G        #################################################################
 128 C        #####################################################################################
 127 T        ############################################################################
 126 C        ####################################################################################################
 125 C        ###############################################
 124 T        ################################################################
 123 C        ################################################################################################
 122 T        ##############################################################################################
 121 A        ###########################################################################################
 120 G        ################################################################
 119 A        ###################################################################
 118 C        ###################################################
 117 T        ########################################################
 116 C        #########################################
 115 G        ################
 114 A        #################
 113 G        ##############
 112 G        ##########
 111 A        ######
 110 A        ######
 109 T        ####
 108 T        ####
 107 C        #####
 106 G        #####
 105 G        ###
 104 T        #####
 103 A        ###
 102 C        ####
 101 C        ####
 100 C        ###
 99 C         ###
 98 C         #####
 97 G         ###
 96 T         ###
 95 A         ###
 94 T         ###
 93 C         ####
 92 A         ###
 91 C         ####
 90 C         ####
 89 G         ####
 88 G         ####
 87 C         ####
 86 G         #####
 85 G         ###
 84 T         #####
 83 G         ####
 82 A         ####
 81 T         #####
 80 A         ####
 79 C         #####
 78 G         ####
 77 A         ####
 76 A         ####
 75 T         ####
 74 T         #####
 73 C         ######
 72 G         #####
 71 T         #####
 70 A         #####
 69 T         ######
 68 C         ######
 67 C         #######
 66 C         #######
 65 T         ####
 64 T         #####
 63 C         
 62 G         ################
 61 G         
 60 T         ###########
 59 G         ########
 58 A         #######
 57 T         ######
 56 A         ######
 55 C         #########
 54 G         ####
 53 C         #######
 52 T         ####
 51 A         ######
 50 G         #####
 49 G         #####
 48 G         #####
 47 G         ######
 46 T         ########
 45 T         ######
 44 C         #########
 43 G         #####
 42 T         ####


Length from nick
-93 A         #
-92 G         #
-91 G         #
-90 G         #
-89 T         #
-88 T         #
-87 T         #
-86 T         #
-85 C         #
-84 C         ###
-83 C         #
-82 A         #
-81 G         ##
-80 T         ##
-79 C         ##
-78 A         #
-77 C         ##
-76 G         #
-75 A         ##
-74 C         ###
-73 G         ##
-72 T         ##
-71 T         ##
-70 G         #
-69 T         ##
-68 A         ##
-67 A         ###
-66 A         ###
-65 A         ###
-64 C         ##
-63 G         ####
-62 A         ###
-61 C         ############
-60 G         ########
-59 G         ########
-58 C         ###########
-57 C         #############
-56 A         ######################
-55 G         ###################################
-54 T         #########################################
-53 G         ####################################################
-52 A         #########################################################
-51 A         #####################################################################
-50 T         ######################################################################
-49 T         ######################################################################
-48 G         ############################################################################################
-47 T         ##############################################################################
-46 A         ######################################################################
-45 A         #################################################
-44 T         ###############################################
-43 A         ############################
-42 C         #####################################
-41 G         ############################
-40 A         ###########################
-39 C         ########################
-38 T         ########################
-37 C         #######################
-36 A         ######################
-35 C         ##################
-34 T         ##########
-33 A         #########
-32 T         ########
-31 A         #########
-30 G         #######
-29 G         #######
-28 G         #####
-27 C         ######
-26 G         #####
-25 A         #####
-24 A         #####
-23 T         #####
-22 T         #####
-21 G         #####
-20 G         #####
-19 G         ####
-18 C         #####
-17 C         #####
-16 C         ######
-15 G         #########
-14 A         ##########
-13 C         ##########
-12 G         ##########
-11 T         #################
-10 C         #################
-9 G          ####################
-8 C          ########################
-7 A          ############################################################
-6 T          ##############################################################
-5 G          #################################################################
-4 C          #####################################################################################
-3 T          ############################################################################
-2 C          ####################################################################################################
-1 C          ###############################################
 1 T          ################################################################
 2 C          ################################################################################################
 3 T          ##############################################################################################
 4 A          ###########################################################################################
 5 G          ################################################################
 6 A          ###################################################################
 7 C          ###################################################
 8 T          ########################################################
 9 C          #########################################
 10 G         ################
 11 A         #################
 12 G         ##############
 13 G         ##########
 14 A         ######
 15 A         ######
 16 T         ####
 17 T         ####
 18 C         #####
 19 G         #####
 20 G         ###
 21 T         #####
 22 A         ###
 23 C         ####
 24 C         ####
 25 C         ###
 26 C         ###
 27 C         #####
 28 G         ###
 29 T         ###
 30 A         ###
 31 T         ###
 32 C         ####
 33 A         ###
 34 C         ####
 35 C         ####
 36 G         ####
 37 G         ####
 38 C         ####
 39 G         #####
 40 G         ###
 41 T         #####
 42 G         ####
 43 A         ####
 44 T         #####
 45 A         ####
 46 C         #####
 47 G         ####
 48 A         ####
 49 A         ####
 50 T         ####
 51 T         #####
 52 C         ######
 53 G         #####
 54 T         #####
 55 A         #####
 56 T         ######
 57 C         ######
 58 C         #######
 59 C         #######
 60 T         ####
 61 T         #####
 62 C         
 63 G         ################
 64 G         
 65 T         ###########
 66 G         ########
 67 A         #######
 68 T         ######
 69 A         ######
 70 C         #########
 71 G         ####
 72 C         #######
 73 T         ####
 74 A         ######
 75 G         #####
 76 G         #####
 77 G         #####
 78 G         ######
 79 T         ########
 80 T         ######
 81 C         #########
 82 G         #####
 83 T         ####


Name of gel and number of scan = No60 def.115
Name of sequence = Clon No 1646
Number of lanes =  21 
Lane for analysis =  13 
Number of analysing nucleotide =  176 
First analysing nucleotide =  133 
3'-nucleotide before nik =  152 
5'-AGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTGTAATACGACTCACTATAGGGCGAATTGGGCCCGACGTCGCATGCTCCTCTAGACTCGAGGAATTCGGTACCCCCGTATCACCGGCGGTGATACGAATTCGTATCCCTTCGGTGATACGCTAGGGGTTCGCGTATCACCGCCGGTGATACGCGAAATCGGTATCCCTTGCGGTGATAGGCCCAAGCGCATAGTGGCGGCCACTATGCGCTTTAGCCATAGGGAACGCCACTATCC0
Length of fragment =  384   P(K)=P(K)/100

 133 A 8522 
 134 C 4116 
 135 G 3166 
 136 A 3810 
 137 C 2440 
 138 G 5528 
 139 G 5277 
 140 C 6636 
 141 C 5820 
 142 A 5419 
 143 G 8521 
 144 T 14940 
 145 G 20258 
 146 A 31444 
 147 A 45185 
 148 T 55319 
 149 T 48596 
 150 G 85906 
 151 T 78999 
 152 A 70303 
 153 A 90081 
 154 T 66010 
 155 A 76453 
 156 C 50131 
 157 G 42081 
 158 A 41853 
 159 C 34528 
 160 T 38147 
 161 C 30799 
 162 A 32973 
 163 C 46138 
 164 T 31992 
 165 A 30952 
 166 T 24259 
 167 A 30178 
 168 G 17336 
 169 G 13665 
 170 G 14011 
 171 C 9821 
 172 G 9496 
 173 A 10205 
 174 A 9925 
 175 T 9128 
 176 T 7784 
 177 G 6751 
 178 G 9006 
 179 G 13600 
 180 C 3518 
 181 C 6626 
 182 C 10936 
 183 G 10283 
 184 A 11222 
 185 C 13913 
 186 G 18225 
 187 T 12910 
 188 C 37338 
 189 G 33081 
 190 C 34598 
 191 A 48314 
 192 T 100109 
 193 G 97034 
 194 C 89469 
 195 T 112982 
 196 C 54851 
 197 C 254652 
 198 T 138681 
 199 C 140164 
 200 T 120713 
 201 A 123818 
 202 G 105738 
 203 A 76748 
 204 C 70338 
 205 T 119012 
 206 C 117643 
 207 G 77758 
 208 A 51591 
 209 G 38708 
 210 G 43433 
 211 A 21684 
 212 A 18250 
 213 T 5556 
 214 T 9902 
 215 C 7758 
 216 G 7943 
 217 G 4409 
 218 T 7562 
 219 A 6757 
 220 C 8467 
 221 C 8416 
 222 C 97 
 223 C 9404 
 224 C 6601 
 225 G 5073 
 226 T 4526 
 227 A 4874 
 228 T 4083 
 229 C 6000 
 230 A 5587 
 231 C 5960 
 232 C 6075 
 233 G 7379 
 234 G 7106 
 235 C 7102 
 236 G 6524 
 237 G 6042 
 238 T 5982 
 239 G 6549 
 240 A 8806 
 241 T 4085 
 242 A 6130 
 243 C 4260 
 244 G 7850 
 245 A 8849 
 246 A 6627 
 247 T 2379 
 248 T 7067 
 249 C 8755 
 250 G 9165 
 251 T 8219 
 252 A 6795 
 253 T 8516 
 254 C 7561 
 255 C 7958 
 256 C 8914 
 257 T 9093 
 258 T 9844 
 259 C 15216 
 260 G 11511 
 261 G 16337 
 262 T 13363 
 263 G 11346 
 264 A 10992 
 265 T 9887 
 266 A 13249 
 267 C 9229 
 268 G 15508 
 269 C 693 
 270 T 15361 
 271 A 13636 
 272 G 11218 
 273 G 9051 
 274 G 320 
 275 G 15855 
 276 T 14877 
 277 T 17548 
 278 C 861 
 279 G 15323 
 280 C 11491 
 281 G 8028 
 282 T 6004 
 283 A 7102 
 284 T 11432 
 285 C 8286 
 286 A 11695 
 287 C 11577 
 288 C 19228 
 289 G 13364 
 290 C 5154 
 291 C 9148 
 292 G 8843 
 293 G 13432 
 294 T 5847 
 295 G 10605 
 296 A 8482 
 297 T 1897 
 298 A 5659 
 299 C 7528 
 300 G 7787 
 301 C 14404 
 302 G 10410 
 303 A 0 
 304 A 7789 
 305 A 5844 
 306 T 14566 
 307 C 6705 
 308 G 15550 

MAX = 254652  MIN = 0 

Length from 5'-end
 133 A        ###
 134 C        #
 135 G        #
 136 A        #
 137 C        
 138 G        ##
 139 G        ##
 140 C        ##
 141 C        ##
 142 A        ##
 143 G        ###
 144 T        #####
 145 G        #######
 146 A        ############
 147 A        #################
 148 T        #####################
 149 T        ###################
 150 G        #################################
 151 T        ###############################
 152 A        ###########################
 153 A        ###################################
 154 T        #########################
 155 A        ##############################
 156 C        ###################
 157 G        ################
 158 A        ################
 159 C        #############
 160 T        ##############
 161 C        ############
 162 A        ############
 163 C        ##################
 164 T        ############
 165 A        ############
 166 T        #########
 167 A        ###########
 168 G        ######
 169 G        #####
 170 G        #####
 171 C        ###
 172 G        ###
 173 A        ####
 174 A        ###
 175 T        ###
 176 T        ###
 177 G        ##
 178 G        ###
 179 G        #####
 180 C        #
 181 C        ##
 182 C        ####
 183 G        ####
 184 A        ####
 185 C        #####
 186 G        #######
 187 T        #####
 188 C        ##############
 189 G        ############
 190 C        #############
 191 A        ##################
 192 T        #######################################
 193 G        ######################################
 194 C        ###################################
 195 T        ############################################
 196 C        #####################
 197 C        ####################################################################################################
 198 T        ######################################################
 199 C        #######################################################
 200 T        ###############################################
 201 A        ################################################
 202 G        #########################################
 203 A        ##############################
 204 C        ###########################
 205 T        ##############################################
 206 C        ##############################################
 207 G        ##############################
 208 A        ####################
 209 G        ###############
 210 G        #################
 211 A        ########
 212 A        #######
 213 T        ##
 214 T        ###
 215 C        ###
 216 G        ###
 217 G        #
 218 T        ##
 219 A        ##
 220 C        ###
 221 C        ###
 222 C        
 223 C        ###
 224 C        ##
 225 G        #
 226 T        #
 227 A        #
 228 T        #
 229 C        ##
 230 A        ##
 231 C        ##
 232 C        ##
 233 G        ##
 234 G        ##
 235 C        ##
 236 G        ##
 237 G        ##
 238 T        ##
 239 G        ##
 240 A        ###
 241 T        #
 242 A        ##
 243 C        #
 244 G        ###
 245 A        ###
 246 A        ##
 247 T        
 248 T        ##
 249 C        ###
 250 G        ###
 251 T        ###
 252 A        ##
 253 T        ###
 254 C        ##
 255 C        ###
 256 C        ###
 257 T        ###
 258 T        ###
 259 C        #####
 260 G        ####
 261 G        ######
 262 T        #####
 263 G        ####
 264 A        ####
 265 T        ###
 266 A        #####
 267 C        ###
 268 G        ######
 269 C        
 270 T        ######
 271 A        #####
 272 G        ####
 273 G        ###
 274 G        
 275 G        ######
 276 T        #####
 277 T        ######
 278 C        
 279 G        ######
 280 C        ####
 281 G        ###
 282 T        ##
 283 A        ##
 284 T        ####
 285 C        ###
 286 A        ####
 287 C        ####
 288 C        #######
 289 G        #####
 290 C        ##
 291 C        ###
 292 G        ###
 293 G        #####
 294 T        ##
 295 G        ####
 296 A        ###
 297 T        
 298 A        ##
 299 C        ##
 300 G        ###
 301 C        #####
 302 G        ####
 303 A        
 304 A        ###
 305 A        ##
 306 T        #####
 307 C        ##
 308 G        ######


Length from 3'-end
 252 A        ###
 251 C        #
 250 G        #
 249 A        #
 248 C        
 247 G        ##
 246 G        ##
 245 C        ##
 244 C        ##
 243 A        ##
 242 G        ###
 241 T        #####
 240 G        #######
 239 A        ############
 238 A        #################
 237 T        #####################
 236 T        ###################
 235 G        #################################
 234 T        ###############################
 233 A        ###########################
 232 A        ###################################
 231 T        #########################
 230 A        ##############################
 229 C        ###################
 228 G        ################
 227 A        ################
 226 C        #############
 225 T        ##############
 224 C        ############
 223 A        ############
 222 C        ##################
 221 T        ############
 220 A        ############
 219 T        #########
 218 A        ###########
 217 G        ######
 216 G        #####
 215 G        #####
 214 C        ###
 213 G        ###
 212 A        ####
 211 A        ###
 210 T        ###
 209 T        ###
 208 G        ##
 207 G        ###
 206 G        #####
 205 C        #
 204 C        ##
 203 C        ####
 202 G        ####
 201 A        ####
 200 C        #####
 199 G        #######
 198 T        #####
 197 C        ##############
 196 G        ############
 195 C        #############
 194 A        ##################
 193 T        #######################################
 192 G        ######################################
 191 C        ###################################
 190 T        ############################################
 189 C        #####################
 188 C        ####################################################################################################
 187 T        ######################################################
 186 C        #######################################################
 185 T        ###############################################
 184 A        ################################################
 183 G        #########################################
 182 A        ##############################
 181 C        ###########################
 180 T        ##############################################
 179 C        ##############################################
 178 G        ##############################
 177 A        ####################
 176 G        ###############
 175 G        #################
 174 A        ########
 173 A        #######
 172 T        ##
 171 T        ###
 170 C        ###
 169 G        ###
 168 G        #
 167 T        ##
 166 A        ##
 165 C        ###
 164 C        ###
 163 C        
 162 C        ###
 161 C        ##
 160 G        #
 159 T        #
 158 A        #
 157 T        #
 156 C        ##
 155 A        ##
 154 C        ##
 153 C        ##
 152 G        ##
 151 G        ##
 150 C        ##
 149 G        ##
 148 G        ##
 147 T        ##
 146 G        ##
 145 A        ###
 144 T        #
 143 A        ##
 142 C        #
 141 G        ###
 140 A        ###
 139 A        ##
 138 T        
 137 T        ##
 136 C        ###
 135 G        ###
 134 T        ###
 133 A        ##
 132 T        ###
 131 C        ##
 130 C        ###
 129 C        ###
 128 T        ###
 127 T        ###
 126 C        #####
 125 G        ####
 124 G        ######
 123 T        #####
 122 G        ####
 121 A        ####
 120 T        ###
 119 A        #####
 118 C        ###
 117 G        ######
 116 C        
 115 T        ######
 114 A        #####
 113 G        ####
 112 G        ###
 111 G        
 110 G        ######
 109 T        #####
 108 T        ######
 107 C        
 106 G        ######
 105 C        ####
 104 G        ###
 103 T        ##
 102 A        ##
 101 T        ####
 100 C        ###
 99 A         ####
 98 C         ####
 97 C         #######
 96 G         #####
 95 C         ##
 94 C         ###
 93 G         ###
 92 G         #####
 91 T         ##
 90 G         ####
 89 A         ###
 88 T         
 87 A         ##
 86 C         ##
 85 G         ###
 84 C         #####
 83 G         ####
 82 A         
 81 A         ###
 80 A         ##
 79 T         #####
 78 C         ##
 77 G         ######


Length from nick
-20 A         ###
-19 C         #
-18 G         #
-17 A         #
-16 C         
-15 G         ##
-14 G         ##
-13 C         ##
-12 C         ##
-11 A         ##
-10 G         ###
-9 T          #####
-8 G          #######
-7 A          ############
-6 A          #################
-5 T          #####################
-4 T          ###################
-3 G          #################################
-2 T          ###############################
-1 A          ###########################
 1 A          ###################################
 2 T          #########################
 3 A          ##############################
 4 C          ###################
 5 G          ################
 6 A          ################
 7 C          #############
 8 T          ##############
 9 C          ############
 10 A         ############
 11 C         ##################
 12 T         ############
 13 A         ############
 14 T         #########
 15 A         ###########
 16 G         ######
 17 G         #####
 18 G         #####
 19 C         ###
 20 G         ###
 21 A         ####
 22 A         ###
 23 T         ###
 24 T         ###
 25 G         ##
 26 G         ###
 27 G         #####
 28 C         #
 29 C         ##
 30 C         ####
 31 G         ####
 32 A         ####
 33 C         #####
 34 G         #######
 35 T         #####
 36 C         ##############
 37 G         ############
 38 C         #############
 39 A         ##################
 40 T         #######################################
 41 G         ######################################
 42 C         ###################################
 43 T         ############################################
 44 C         #####################
 45 C         ####################################################################################################
 46 T         ######################################################
 47 C         #######################################################
 48 T         ###############################################
 49 A         ################################################
 50 G         #########################################
 51 A         ##############################
 52 C         ###########################
 53 T         ##############################################
 54 C         ##############################################
 55 G         ##############################
 56 A         ####################
 57 G         ###############
 58 G         #################
 59 A         ########
 60 A         #######
 61 T         ##
 62 T         ###
 63 C         ###
 64 G         ###
 65 G         #
 66 T         ##
 67 A         ##
 68 C         ###
 69 C         ###
 70 C         
 71 C         ###
 72 C         ##
 73 G         #
 74 T         #
 75 A         #
 76 T         #
 77 C         ##
 78 A         ##
 79 C         ##
 80 C         ##
 81 G         ##
 82 G         ##
 83 C         ##
 84 G         ##
 85 G         ##
 86 T         ##
 87 G         ##
 88 A         ###
 89 T         #
 90 A         ##
 91 C         #
 92 G         ###
 93 A         ###
 94 A         ##
 95 T         
 96 T         ##
 97 C         ###
 98 G         ###
 99 T         ###
 100 A        ##
 101 T        ###
 102 C        ##
 103 C        ###
 104 C        ###
 105 T        ###
 106 T        ###
 107 C        #####
 108 G        ####
 109 G        ######
 110 T        #####
 111 G        ####
 112 A        ####
 113 T        ###
 114 A        #####
 115 C        ###
 116 G        ######
 117 C        
 118 T        ######
 119 A        #####
 120 G        ####
 121 G        ###
 122 G        
 123 G        ######
 124 T        #####
 125 T        ######
 126 C        
 127 G        ######
 128 C        ####
 129 G        ###
 130 T        ##
 131 A        ##
 132 T        ####
 133 C        ###
 134 A        ####
 135 C        ####
 136 C        #######
 137 G        #####
 138 C        ##
 139 C        ###
 140 G        ###
 141 G        #####
 142 T        ##
 143 G        ####
 144 A        ###
 145 T        
 146 A        ##
 147 C        ##
 148 G        ###
 149 C        #####
 150 G        ####
 151 A        
 152 A        ###
 153 A        ##
 154 T        #####
 155 C        ##
 156 G        ######


Name of gel and number of scan = No65 def.193 - 4 sec
Name of sequence = Clon No 1670
Number of lanes =  11 
Lane for analysis =  4 
Number of analysing nucleotide =  241 
First analysing nucleotide =  142 
3'-nucleotide before nik =  197 
5'-AGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTGTAATACGACTCACTATAGGGCGAATTGGGCCCGACGTCGCATGCTCCTCTAGACTCGAGGAATTCGGTACCCCCGTATCACCGGCGGTGATACGAATTCGTATCCCTTCGGTGATACGCTAGGGGTTCGCGTATCACCGCCGGTGATACGCGAAATCCTATCACCGCAAGGGATACCGGTATCCCTTGCGGTGATAGGGGTATCCCTTGCGGTGATAGGGGTATCACCGCGGTGATAGG0
Length of fragment =  389   P(K)=P(K)/100

 142 A 736 
 143 G 136 
 144 T 290 
 145 G 99 
 146 A 780 
 147 A 362 
 148 T 317 
 149 T 272 
 150 G 240 
 151 T 481 
 152 A 721 
 153 A 646 
 154 T 821 
 155 A 870 
 156 C 1178 
 157 G 1391 
 158 A 906 
 159 C 1121 
 160 T 734 
 161 C 841 
 162 A 1161 
 163 C 773 
 164 T 541 
 165 A 817 
 166 T 727 
 167 A 481 
 168 G 332 
 169 G 366 
 170 G 268 
 171 C 308 
 172 G 365 
 173 A 192 
 174 A 234 
 175 T 227 
 176 T 168 
 177 G 200 
 178 G 163 
 179 G 242 
 180 C 279 
 181 C 222 
 182 C 343 
 183 G 298 
 184 A 199 
 185 C 260 
 186 G 335 
 187 T 687 
 188 C 619 
 189 G 710 
 190 C 681 
 191 A 852 
 192 T 716 
 193 G 1666 
 194 C 1025 
 195 T 1454 
 196 C 1726 
 197 C 1407 
 198 T 1930 
 199 C 1929 
 200 T 1811 
 201 A 1593 
 202 G 1644 
 203 A 955 
 204 C 1122 
 205 T 610 
 206 C 754 
 207 G 408 
 208 A 430 
 209 G 676 
 210 G 559 
 211 A 366 
 212 A 413 
 213 T 290 
 214 T 278 
 215 C 195 
 216 G 63 
 217 G 228 
 218 T 230 
 219 A 197 
 220 C 295 
 221 C 230 
 222 C 227 
 223 C 244 
 224 C 217 
 225 G 228 
 226 T 213 
 227 A 241 
 228 T 244 
 229 C 186 
 230 A 216 
 231 C 298 
 232 C 257 
 233 G 165 
 234 G 256 
 235 C 252 
 236 G 110 
 237 G 198 
 238 T 234 
 239 G 232 
 240 A 291 
 241 T 260 
 242 A 243 
 243 C 299 
 244 G 240 
 245 A 262 
 246 A 232 
 247 T 214 
 248 T 170 
 249 C 237 
 250 G 288 
 251 T 210 
 252 A 238 
 253 T 271 
 254 C 236 
 255 C 212 
 256 C 250 
 257 T 257 
 258 T 263 
 259 C 278 
 260 G 233 
 261 G 233 
 262 T 282 
 263 G 293 
 264 A 225 
 265 T 240 
 266 A 261 
 267 C 297 
 268 G 268 
 269 C 252 
 270 T 198 
 271 A 248 
 272 G 321 
 273 G 328 
 274 G 272 
 275 G 262 
 276 T 270 
 277 T 284 
 278 C 237 
 279 G 375 
 280 C 283 
 281 G 315 
 282 T 311 
 283 A 319 
 284 T 285 
 285 C 326 
 286 A 295 
 287 C 369 
 288 C 374 
 289 G 331 
 290 C 337 
 291 C 342 
 292 G 371 
 293 G 367 
 294 T 373 
 295 G 396 
 296 A 315 
 297 T 352 
 298 A 356 
 299 C 438 
 300 G 376 
 301 C 360 
 302 G 346 
 303 A 359 
 304 A 356 
 305 A 327 
 306 T 303 
 307 C 344 
 308 C 328 
 309 T 315 
 310 A 349 
 311 T 360 
 312 C 396 
 313 A 309 
 314 C 276 
 315 C 402 
 316 G 365 
 317 C 362 
 318 A 331 
 319 A 327 
 320 G 369 
 321 G 366 
 322 G 365 
 323 A 321 
 324 T 343 
 325 A 331 
 326 C 382 
 327 C 368 
 328 G 322 
 329 G 408 
 330 T 412 
 331 A 304 
 332 T 348 
 333 C 352 
 334 C 331 
 335 C 364 
 336 T 353 
 337 T 359 
 338 G 391 
 339 C 395 
 340 G 429 
 341 G 357 
 342 T 347 
 343 G 440 
 344 A 313 
 345 T 373 
 346 A 349 
 347 G 352 
 348 G 382 
 349 G 397 
 350 G 375 
 351 T 381 
 352 A 309 
 353 T 317 
 354 C 371 
 355 C 328 
 356 C 371 
 357 T 330 
 358 T 377 
 359 G 368 
 360 C 373 
 361 G 382 
 362 G 354 
 363 T 354 
 364 G 403 
 365 A 307 
 366 T 364 
 367 A 372 
 368 G 415 
 369 G 423 
 370 G 433 
 371 G 401 
 372 T 330 
 373 A 394 
 374 T 350 
 375 C 409 
 376 A 339 
 377 C 300 
 378 C 373 
 379 G 334 
 380 C 415 
 381 G 444 
 382 G 675 

MAX = 1930    MIN = 63 

Length from 5'-end
 142 A        ##################################
 143 G        ###
 144 T        ###########
 145 G        #
 146 A        #####################################
 147 A        ###############
 148 T        #############
 149 T        ##########
 150 G        #########
 151 T        #####################
 152 A        ##################################
 153 A        ##############################
 154 T        #######################################
 155 A        #########################################
 156 C        #########################################################
 157 G        ####################################################################
 158 A        ###########################################
 159 C        ######################################################
 160 T        ##################################
 161 C        ########################################
 162 A        ########################################################
 163 C        ####################################
 164 T        ########################
 165 A        #######################################
 166 T        ##################################
 167 A        #####################
 168 G        #############
 169 G        ###############
 170 G        ##########
 171 C        ############
 172 G        ###############
 173 A        ######
 174 A        ########
 175 T        ########
 176 T        #####
 177 G        #######
 178 G        #####
 179 G        #########
 180 C        ###########
 181 C        ########
 182 C        ##############
 183 G        ############
 184 A        #######
 185 C        ##########
 186 G        ##############
 187 T        ################################
 188 C        ############################
 189 G        #################################
 190 C        ################################
 191 A        ########################################
 192 T        #################################
 193 G        ###################################################################################
 194 C        #################################################
 195 T        ########################################################################
 196 C        ######################################################################################
 197 C        #####################################################################
 198 T        ################################################################################################
 199 C        ################################################################################################
 200 T        ##########################################################################################
 201 A        ###############################################################################
 202 G        #################################################################################
 203 A        ##############################################
 204 C        ######################################################
 205 T        ############################
 206 C        ###################################
 207 G        #################
 208 A        ###################
 209 G        ###############################
 210 G        #########################
 211 A        ###############
 212 A        ##################
 213 T        ###########
 214 T        ###########
 215 C        ######
 216 G        
 217 G        ########
 218 T        ########
 219 A        ######
 220 C        ############
 221 C        ########
 222 C        ########
 223 C        #########
 224 C        #######
 225 G        ########
 226 T        #######
 227 A        #########
 228 T        #########
 229 C        ######
 230 A        #######
 231 C        ############
 232 C        ##########
 233 G        #####
 234 G        ##########
 235 C        #########
 236 G        ##
 237 G        ######
 238 T        ########
 239 G        ########
 240 A        ###########
 241 T        ##########
 242 A        #########
 243 C        ############
 244 G        #########
 245 A        ##########
 246 A        ########
 247 T        #######
 248 T        #####
 249 C        #########
 250 G        ###########
 251 T        #######
 252 A        #########
 253 T        ##########
 254 C        ########
 255 C        #######
 256 C        #########
 257 T        ##########
 258 T        ##########
 259 C        ###########
 260 G        ########
 261 G        ########
 262 T        ###########
 263 G        ###########
 264 A        ########
 265 T        #########
 266 A        ##########
 267 C        ############
 268 G        ##########
 269 C        #########
 270 T        ######
 271 A        #########
 272 G        #############
 273 G        #############
 274 G        ##########
 275 G        ##########
 276 T        ##########
 277 T        ###########
 278 C        #########
 279 G        ################
 280 C        ###########
 281 G        #############
 282 T        ############
 283 A        #############
 284 T        ###########
 285 C        #############
 286 A        ############
 287 C        ###############
 288 C        ################
 289 G        #############
 290 C        ##############
 291 C        ##############
 292 G        ###############
 293 G        ###############
 294 T        ################
 295 G        #################
 296 A        #############
 297 T        ##############
 298 A        ###############
 299 C        ###################
 300 G        ################
 301 C        ###############
 302 G        ##############
 303 A        ###############
 304 A        ###############
 305 A        #############
 306 T        ############
 307 C        ##############
 308 C        #############
 309 T        #############
 310 A        ##############
 311 T        ###############
 312 C        #################
 313 A        ############
 314 C        ###########
 315 C        #################
 316 G        ###############
 317 C        ###############
 318 A        #############
 319 A        #############
 320 G        ###############
 321 G        ###############
 322 G        ###############
 323 A        #############
 324 T        ##############
 325 A        #############
 326 C        ################
 327 C        ###############
 328 G        #############
 329 G        #################
 330 T        ##################
 331 A        ############
 332 T        ##############
 333 C        ##############
 334 C        #############
 335 C        ###############
 336 T        ###############
 337 T        ###############
 338 G        ################
 339 C        #################
 340 G        ##################
 341 G        ###############
 342 T        ##############
 343 G        ###################
 344 A        ############
 345 T        ################
 346 A        ##############
 347 G        ##############
 348 G        ################
 349 G        #################
 350 G        ################
 351 T        ################
 352 A        ############
 353 T        #############
 354 C        ###############
 355 C        #############
 356 C        ###############
 357 T        #############
 358 T        ################
 359 G        ###############
 360 C        ################
 361 G        ################
 362 G        ###############
 363 T        ###############
 364 G        #################
 365 A        ############
 366 T        ###############
 367 A        ################
 368 G        ##################
 369 G        ##################
 370 G        ###################
 371 G        #################
 372 T        #############
 373 A        #################
 374 T        ##############
 375 C        #################
 376 A        ##############
 377 C        ############
 378 C        ################
 379 G        ##############
 380 C        ##################
 381 G        ###################
 382 G        ###############################


Length from 3'-end
 248 A        ##################################
 247 G        ###
 246 T        ###########
 245 G        #
 244 A        #####################################
 243 A        ###############
 242 T        #############
 241 T        ##########
 240 G        #########
 239 T        #####################
 238 A        ##################################
 237 A        ##############################
 236 T        #######################################
 235 A        #########################################
 234 C        #########################################################
 233 G        ####################################################################
 232 A        ###########################################
 231 C        ######################################################
 230 T        ##################################
 229 C        ########################################
 228 A        ########################################################
 227 C        ####################################
 226 T        ########################
 225 A        #######################################
 224 T        ##################################
 223 A        #####################
 222 G        #############
 221 G        ###############
 220 G        ##########
 219 C        ############
 218 G        ###############
 217 A        ######
 216 A        ########
 215 T        ########
 214 T        #####
 213 G        #######
 212 G        #####
 211 G        #########
 210 C        ###########
 209 C        ########
 208 C        ##############
 207 G        ############
 206 A        #######
 205 C        ##########
 204 G        ##############
 203 T        ################################
 202 C        ############################
 201 G        #################################
 200 C        ################################
 199 A        ########################################
 198 T        #################################
 197 G        ###################################################################################
 196 C        #################################################
 195 T        ########################################################################
 194 C        ######################################################################################
 193 C        #####################################################################
 192 T        ################################################################################################
 191 C        ################################################################################################
 190 T        ##########################################################################################
 189 A        ###############################################################################
 188 G        #################################################################################
 187 A        ##############################################
 186 C        ######################################################
 185 T        ############################
 184 C        ###################################
 183 G        #################
 182 A        ###################
 181 G        ###############################
 180 G        #########################
 179 A        ###############
 178 A        ##################
 177 T        ###########
 176 T        ###########
 175 C        ######
 174 G        
 173 G        ########
 172 T        ########
 171 A        ######
 170 C        ############
 169 C        ########
 168 C        ########
 167 C        #########
 166 C        #######
 165 G        ########
 164 T        #######
 163 A        #########
 162 T        #########
 161 C        ######
 160 A        #######
 159 C        ############
 158 C        ##########
 157 G        #####
 156 G        ##########
 155 C        #########
 154 G        ##
 153 G        ######
 152 T        ########
 151 G        ########
 150 A        ###########
 149 T        ##########
 148 A        #########
 147 C        ############
 146 G        #########
 145 A        ##########
 144 A        ########
 143 T        #######
 142 T        #####
 141 C        #########
 140 G        ###########
 139 T        #######
 138 A        #########
 137 T        ##########
 136 C        ########
 135 C        #######
 134 C        #########
 133 T        ##########
 132 T        ##########
 131 C        ###########
 130 G        ########
 129 G        ########
 128 T        ###########
 127 G        ###########
 126 A        ########
 125 T        #########
 124 A        ##########
 123 C        ############
 122 G        ##########
 121 C        #########
 120 T        ######
 119 A        #########
 118 G        #############
 117 G        #############
 116 G        ##########
 115 G        ##########
 114 T        ##########
 113 T        ###########
 112 C        #########
 111 G        ################
 110 C        ###########
 109 G        #############
 108 T        ############
 107 A        #############
 106 T        ###########
 105 C        #############
 104 A        ############
 103 C        ###############
 102 C        ################
 101 G        #############
 100 C        ##############
 99 C         ##############
 98 G         ###############
 97 G         ###############
 96 T         ################
 95 G         #################
 94 A         #############
 93 T         ##############
 92 A         ###############
 91 C         ###################
 90 G         ################
 89 C         ###############
 88 G         ##############
 87 A         ###############
 86 A         ###############
 85 A         #############
 84 T         ############
 83 C         ##############
 82 C         #############
 81 T         #############
 80 A         ##############
 79 T         ###############
 78 C         #################
 77 A         ############
 76 C         ###########
 75 C         #################
 74 G         ###############
 73 C         ###############
 72 A         #############
 71 A         #############
 70 G         ###############
 69 G         ###############
 68 G         ###############
 67 A         #############
 66 T         ##############
 65 A         #############
 64 C         ################
 63 C         ###############
 62 G         #############
 61 G         #################
 60 T         ##################
 59 A         ############
 58 T         ##############
 57 C         ##############
 56 C         #############
 55 C         ###############
 54 T         ###############
 53 T         ###############
 52 G         ################
 51 C         #################
 50 G         ##################
 49 G         ###############
 48 T         ##############
 47 G         ###################
 46 A         ############
 45 T         ################
 44 A         ##############
 43 G         ##############
 42 G         ################
 41 G         #################
 40 G         ################
 39 T         ################
 38 A         ############
 37 T         #############
 36 C         ###############
 35 C         #############
 34 C         ###############
 33 T         #############
 32 T         ################
 31 G         ###############
 30 C         ################
 29 G         ################
 28 G         ###############
 27 T         ###############
 26 G         #################
 25 A         ############
 24 T         ###############
 23 A         ################
 22 G         ##################
 21 G         ##################
 20 G         ###################
 19 G         #################
 18 T         #############
 17 A         #################
 16 T         ##############
 15 C         #################
 14 A         ##############
 13 C         ############
 12 C         ################
 11 G         ##############
 10 C         ##################
 9 G          ###################
 8 G          ###############################


Length from nick
-56 A         ##################################
-55 G         ###
-54 T         ###########
-53 G         #
-52 A         #####################################
-51 A         ###############
-50 T         #############
-49 T         ##########
-48 G         #########
-47 T         #####################
-46 A         ##################################
-45 A         ##############################
-44 T         #######################################
-43 A         #########################################
-42 C         #########################################################
-41 G         ####################################################################
-40 A         ###########################################
-39 C         ######################################################
-38 T         ##################################
-37 C         ########################################
-36 A         ########################################################
-35 C         ####################################
-34 T         ########################
-33 A         #######################################
-32 T         ##################################
-31 A         #####################
-30 G         #############
-29 G         ###############
-28 G         ##########
-27 C         ############
-26 G         ###############
-25 A         ######
-24 A         ########
-23 T         ########
-22 T         #####
-21 G         #######
-20 G         #####
-19 G         #########
-18 C         ###########
-17 C         ########
-16 C         ##############
-15 G         ############
-14 A         #######
-13 C         ##########
-12 G         ##############
-11 T         ################################
-10 C         ############################
-9 G          #################################
-8 C          ################################
-7 A          ########################################
-6 T          #################################
-5 G          ###################################################################################
-4 C          #################################################
-3 T          ########################################################################
-2 C          ######################################################################################
-1 C          #####################################################################
 1 T          ################################################################################################
 2 C          ################################################################################################
 3 T          ##########################################################################################
 4 A          ###############################################################################
 5 G          #################################################################################
 6 A          ##############################################
 7 C          ######################################################
 8 T          ############################
 9 C          ###################################
 10 G         #################
 11 A         ###################
 12 G         ###############################
 13 G         #########################
 14 A         ###############
 15 A         ##################
 16 T         ###########
 17 T         ###########
 18 C         ######
 19 G         
 20 G         ########
 21 T         ########
 22 A         ######
 23 C         ############
 24 C         ########
 25 C         ########
 26 C         #########
 27 C         #######
 28 G         ########
 29 T         #######
 30 A         #########
 31 T         #########
 32 C         ######
 33 A         #######
 34 C         ############
 35 C         ##########
 36 G         #####
 37 G         ##########
 38 C         #########
 39 G         ##
 40 G         ######
 41 T         ########
 42 G         ########
 43 A         ###########
 44 T         ##########
 45 A         #########
 46 C         ############
 47 G         #########
 48 A         ##########
 49 A         ########
 50 T         #######
 51 T         #####
 52 C         #########
 53 G         ###########
 54 T         #######
 55 A         #########
 56 T         ##########
 57 C         ########
 58 C         #######
 59 C         #########
 60 T         ##########
 61 T         ##########
 62 C         ###########
 63 G         ########
 64 G         ########
 65 T         ###########
 66 G         ###########
 67 A         ########
 68 T         #########
 69 A         ##########
 70 C         ############
 71 G         ##########
 72 C         #########
 73 T         ######
 74 A         #########
 75 G         #############
 76 G         #############
 77 G         ##########
 78 G         ##########
 79 T         ##########
 80 T         ###########
 81 C         #########
 82 G         ################
 83 C         ###########
 84 G         #############
 85 T         ############
 86 A         #############
 87 T         ###########
 88 C         #############
 89 A         ############
 90 C         ###############
 91 C         ################
 92 G         #############
 93 C         ##############
 94 C         ##############
 95 G         ###############
 96 G         ###############
 97 T         ################
 98 G         #################
 99 A         #############
 100 T        ##############
 101 A        ###############
 102 C        ###################
 103 G        ################
 104 C        ###############
 105 G        ##############
 106 A        ###############
 107 A        ###############
 108 A        #############
 109 T        ############
 110 C        ##############
 111 C        #############
 112 T        #############
 113 A        ##############
 114 T        ###############
 115 C        #################
 116 A        ############
 117 C        ###########
 118 C        #################
 119 G        ###############
 120 C        ###############
 121 A        #############
 122 A        #############
 123 G        ###############
 124 G        ###############
 125 G        ###############
 126 A        #############
 127 T        ##############
 128 A        #############
 129 C        ################
 130 C        ###############
 131 G        #############
 132 G        #################
 133 T        ##################
 134 A        ############
 135 T        ##############
 136 C        ##############
 137 C        #############
 138 C        ###############
 139 T        ###############
 140 T        ###############
 141 G        ################
 142 C        #################
 143 G        ##################
 144 G        ###############
 145 T        ##############
 146 G        ###################
 147 A        ############
 148 T        ################
 149 A        ##############
 150 G        ##############
 151 G        ################
 152 G        #################
 153 G        ################
 154 T        ################
 155 A        ############
 156 T        #############
 157 C        ###############
 158 C        #############
 159 C        ###############
 160 T        #############
 161 T        ################
 162 G        ###############
 163 C        ################
 164 G        ################
 165 G        ###############
 166 T        ###############
 167 G        #################
 168 A        ############
 169 T        ###############
 170 A        ################
 171 G        ##################
 172 G        ##################
 173 G        ###################
 174 G        #################
 175 T        #############
 176 A        #################
 177 T        ##############
 178 C        #################
 179 A        ##############
 180 C        ############
 181 C        ################
 182 G        ##############
 183 C        ##################
 184 G        ###################
 185 G        ###############################


Name of gel and number of scan = No65 def.193 - 8 sec
Name of sequence = Clon No 1670
Number of lanes =  11 
Lane for analysis =  5 
Number of analysing nucleotide =  241 
First analysing nucleotide =  142 
3'-nucleotide before nik =  197 
5'-AGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTGTAATACGACTCACTATAGGGCGAATTGGGCCCGACGTCGCATGCTCCTCTAGACTCGAGGAATTCGGTACCCCCGTATCACCGGCGGTGATACGAATTCGTATCCCTTCGGTGATACGCTAGGGGTTCGCGTATCACCGCCGGTGATACGCGAAATCCTATCACCGCAAGGGATACCGGTATCCCTTGCGGTGATAGGGGTATCCCTTGCGGTGATAGGGGTATCACCGCGGTGATAGG0
Length of fragment =  389   P(K)=P(K)/100

 142 A 1402 
 143 G 16 
 144 T 4616 
 145 G 33 
 146 A 1072 
 147 A 526 
 148 T 531 
 149 T 786 
 150 G 637 
 151 T 686 
 152 A 2085 
 153 A 2540 
 154 T 3333 
 155 A 2884 
 156 C 4892 
 157 G 6555 
 158 A 3711 
 159 C 3809 
 160 T 3715 
 161 C 3711 
 162 A 4298 
 163 C 1632 
 164 T 1543 
 165 A 3115 
 166 T 1847 
 167 A 1291 
 168 G 594 
 169 G 890 
 170 G 530 
 171 C 539 
 172 G 602 
 173 A 662 
 174 A 530 
 175 T 305 
 176 T 334 
 177 G 239 
 178 G 447 
 179 G 310 
 180 C 515 
 181 C 556 
 182 C 599 
 183 G 565 
 184 A 400 
 185 C 684 
 186 G 911 
 187 T 1369 
 188 C 1569 
 189 G 2846 
 190 C 2421 
 191 A 2483 
 192 T 2896 
 193 G 1612 
 194 C 2752 
 195 T 7478 
 196 C 2409 
 197 C 6377 
 198 T 7601 
 199 C 17626 
 200 T 8028 
 201 A 6738 
 202 G 4632 
 203 A 2658 
 204 C 4722 
 205 T 3350 
 206 C 2874 
 207 G 2378 
 208 A 1526 
 209 G 1393 
 210 G 1153 
 211 A 815 
 212 A 924 
 213 T 535 
 214 T 599 
 215 C 580 
 216 G 166 
 217 G 225 
 218 T 672 
 219 A 448 
 220 C 591 
 221 C 447 
 222 C 428 
 223 C 451 
 224 C 430 
 225 G 299 
 226 T 588 
 227 A 529 
 228 T 493 
 229 C 487 
 230 A 459 
 231 C 565 
 232 C 466 
 233 G 359 
 234 G 344 
 235 C 520 
 236 G 105 
 237 G 485 
 238 T 376 
 239 G 392 
 240 A 850 
 241 T 521 
 242 A 528 
 243 C 480 
 244 G 613 
 245 A 402 
 246 A 368 
 247 T 325 
 248 T 577 
 249 C 418 
 250 G 460 
 251 T 454 
 252 A 474 
 253 T 478 
 254 C 470 
 255 C 449 
 256 C 468 
 257 T 499 
 258 T 444 
 259 C 753 
 260 G 520 
 261 G 486 
 262 T 536 
 263 G 546 
 264 A 556 
 265 T 500 
 266 A 510 
 267 C 659 
 268 G 596 
 269 C 539 
 270 T 484 
 271 A 562 
 272 G 539 
 273 G 630 
 274 G 606 
 275 G 557 
 276 T 526 
 277 T 579 
 278 C 294 
 279 G 1170 
 280 C 621 
 281 G 629 
 282 T 600 
 283 A 589 
 284 T 675 
 285 C 623 
 286 A 444 
 287 C 759 
 288 C 814 
 289 G 626 
 290 C 594 
 291 C 764 
 292 G 645 
 293 G 729 
 294 T 654 
 295 G 1020 
 296 A 410 
 297 T 666 
 298 A 658 
 299 C 680 
 300 G 691 
 301 C 782 
 302 G 616 
 303 A 593 
 304 A 761 
 305 A 579 
 306 T 558 
 307 C 625 
 308 C 708 
 309 T 670 
 310 A 609 
 311 T 624 
 312 C 985 
 313 A 469 
 314 C 704 
 315 C 883 
 316 G 635 
 317 C 947 
 318 A 811 
 319 A 604 
 320 G 687 
 321 G 644 
 322 G 652 
 323 A 544 
 324 T 779 
 325 A 586 
 326 C 758 
 327 C 751 
 328 G 632 
 329 G 730 
 330 T 780 
 331 A 539 
 332 T 676 
 333 C 660 
 334 C 681 
 335 C 697 
 336 T 678 
 337 T 650 
 338 G 785 
 339 C 785 
 340 G 707 
 341 G 652 
 342 T 648 
 343 G 890 
 344 A 507 
 345 T 667 
 346 A 583 
 347 G 695 
 348 G 629 
 349 G 727 
 350 G 586 
 351 T 677 
 352 A 596 
 353 T 529 
 354 C 699 
 355 C 588 
 356 C 576 
 357 T 576 
 358 T 588 
 359 G 736 
 360 C 642 
 361 G 647 
 362 G 622 
 363 T 478 
 364 G 828 
 365 A 431 
 366 T 628 
 367 A 612 
 368 G 649 
 369 G 590 
 370 G 664 
 371 G 642 
 372 T 552 
 373 A 583 
 374 T 484 
 375 C 716 
 376 A 493 
 377 C 501 
 378 C 563 
 379 G 489 
 380 C 593 
 381 G 628 
 382 G 1199 

MAX = 17626   MIN = 16 

Length from 5'-end
 142 A        #######
 143 G        
 144 T        ##########################
 145 G        
 146 A        #####
 147 A        ##
 148 T        ##
 149 T        ####
 150 G        ###
 151 T        ###
 152 A        ###########
 153 A        ##############
 154 T        ##################
 155 A        ################
 156 C        ###########################
 157 G        #####################################
 158 A        ####################
 159 C        #####################
 160 T        ####################
 161 C        ####################
 162 A        ########################
 163 C        #########
 164 T        ########
 165 A        #################
 166 T        ##########
 167 A        #######
 168 G        ###
 169 G        ####
 170 G        ##
 171 C        ##
 172 G        ###
 173 A        ###
 174 A        ##
 175 T        #
 176 T        #
 177 G        #
 178 G        ##
 179 G        #
 180 C        ##
 181 C        ###
 182 C        ###
 183 G        ###
 184 A        ##
 185 C        ###
 186 G        #####
 187 T        #######
 188 C        ########
 189 G        ################
 190 C        #############
 191 A        #############
 192 T        ################
 193 G        #########
 194 C        ###############
 195 T        ##########################################
 196 C        #############
 197 C        ####################################
 198 T        ###########################################
 199 C        ###################################################################################################
 200 T        #############################################
 201 A        ######################################
 202 G        ##########################
 203 A        ##############
 204 C        ##########################
 205 T        ##################
 206 C        ################
 207 G        #############
 208 A        ########
 209 G        #######
 210 G        ######
 211 A        ####
 212 A        #####
 213 T        ##
 214 T        ###
 215 C        ###
 216 G        
 217 G        #
 218 T        ###
 219 A        ##
 220 C        ###
 221 C        ##
 222 C        ##
 223 C        ##
 224 C        ##
 225 G        #
 226 T        ###
 227 A        ##
 228 T        ##
 229 C        ##
 230 A        ##
 231 C        ###
 232 C        ##
 233 G        #
 234 G        #
 235 C        ##
 236 G        
 237 G        ##
 238 T        ##
 239 G        ##
 240 A        ####
 241 T        ##
 242 A        ##
 243 C        ##
 244 G        ###
 245 A        ##
 246 A        #
 247 T        #
 248 T        ###
 249 C        ##
 250 G        ##
 251 T        ##
 252 A        ##
 253 T        ##
 254 C        ##
 255 C        ##
 256 C        ##
 257 T        ##
 258 T        ##
 259 C        ####
 260 G        ##
 261 G        ##
 262 T        ##
 263 G        ###
 264 A        ###
 265 T        ##
 266 A        ##
 267 C        ###
 268 G        ###
 269 C        ##
 270 T        ##
 271 A        ###
 272 G        ##
 273 G        ###
 274 G        ###
 275 G        ###
 276 T        ##
 277 T        ###
 278 C        #
 279 G        ######
 280 C        ###
 281 G        ###
 282 T        ###
 283 A        ###
 284 T        ###
 285 C        ###
 286 A        ##
 287 C        ####
 288 C        ####
 289 G        ###
 290 C        ###
 291 C        ####
 292 G        ###
 293 G        ####
 294 T        ###
 295 G        #####
 296 A        ##
 297 T        ###
 298 A        ###
 299 C        ###
 300 G        ###
 301 C        ####
 302 G        ###
 303 A        ###
 304 A        ####
 305 A        ###
 306 T        ###
 307 C        ###
 308 C        ###
 309 T        ###
 310 A        ###
 311 T        ###
 312 C        #####
 313 A        ##
 314 C        ###
 315 C        ####
 316 G        ###
 317 C        #####
 318 A        ####
 319 A        ###
 320 G        ###
 321 G        ###
 322 G        ###
 323 A        ##
 324 T        ####
 325 A        ###
 326 C        ####
 327 C        ####
 328 G        ###
 329 G        ####
 330 T        ####
 331 A        ##
 332 T        ###
 333 C        ###
 334 C        ###
 335 C        ###
 336 T        ###
 337 T        ###
 338 G        ####
 339 C        ####
 340 G        ###
 341 G        ###
 342 T        ###
 343 G        ####
 344 A        ##
 345 T        ###
 346 A        ###
 347 G        ###
 348 G        ###
 349 G        ####
 350 G        ###
 351 T        ###
 352 A        ###
 353 T        ##
 354 C        ###
 355 C        ###
 356 C        ###
 357 T        ###
 358 T        ###
 359 G        ####
 360 C        ###
 361 G        ###
 362 G        ###
 363 T        ##
 364 G        ####
 365 A        ##
 366 T        ###
 367 A        ###
 368 G        ###
 369 G        ###
 370 G        ###
 371 G        ###
 372 T        ###
 373 A        ###
 374 T        ##
 375 C        ###
 376 A        ##
 377 C        ##
 378 C        ###
 379 G        ##
 380 C        ###
 381 G        ###
 382 G        ######


Length from 3'-end
 248 A        #######
 247 G        
 246 T        ##########################
 245 G        
 244 A        #####
 243 A        ##
 242 T        ##
 241 T        ####
 240 G        ###
 239 T        ###
 238 A        ###########
 237 A        ##############
 236 T        ##################
 235 A        ################
 234 C        ###########################
 233 G        #####################################
 232 A        ####################
 231 C        #####################
 230 T        ####################
 229 C        ####################
 228 A        ########################
 227 C        #########
 226 T        ########
 225 A        #################
 224 T        ##########
 223 A        #######
 222 G        ###
 221 G        ####
 220 G        ##
 219 C        ##
 218 G        ###
 217 A        ###
 216 A        ##
 215 T        #
 214 T        #
 213 G        #
 212 G        ##
 211 G        #
 210 C        ##
 209 C        ###
 208 C        ###
 207 G        ###
 206 A        ##
 205 C        ###
 204 G        #####
 203 T        #######
 202 C        ########
 201 G        ################
 200 C        #############
 199 A        #############
 198 T        ################
 197 G        #########
 196 C        ###############
 195 T        ##########################################
 194 C        #############
 193 C        ####################################
 192 T        ###########################################
 191 C        ###################################################################################################
 190 T        #############################################
 189 A        ######################################
 188 G        ##########################
 187 A        ##############
 186 C        ##########################
 185 T        ##################
 184 C        ################
 183 G        #############
 182 A        ########
 181 G        #######
 180 G        ######
 179 A        ####
 178 A        #####
 177 T        ##
 176 T        ###
 175 C        ###
 174 G        
 173 G        #
 172 T        ###
 171 A        ##
 170 C        ###
 169 C        ##
 168 C        ##
 167 C        ##
 166 C        ##
 165 G        #
 164 T        ###
 163 A        ##
 162 T        ##
 161 C        ##
 160 A        ##
 159 C        ###
 158 C        ##
 157 G        #
 156 G        #
 155 C        ##
 154 G        
 153 G        ##
 152 T        ##
 151 G        ##
 150 A        ####
 149 T        ##
 148 A        ##
 147 C        ##
 146 G        ###
 145 A        ##
 144 A        #
 143 T        #
 142 T        ###
 141 C        ##
 140 G        ##
 139 T        ##
 138 A        ##
 137 T        ##
 136 C        ##
 135 C        ##
 134 C        ##
 133 T        ##
 132 T        ##
 131 C        ####
 130 G        ##
 129 G        ##
 128 T        ##
 127 G        ###
 126 A        ###
 125 T        ##
 124 A        ##
 123 C        ###
 122 G        ###
 121 C        ##
 120 T        ##
 119 A        ###
 118 G        ##
 117 G        ###
 116 G        ###
 115 G        ###
 114 T        ##
 113 T        ###
 112 C        #
 111 G        ######
 110 C        ###
 109 G        ###
 108 T        ###
 107 A        ###
 106 T        ###
 105 C        ###
 104 A        ##
 103 C        ####
 102 C        ####
 101 G        ###
 100 C        ###
 99 C         ####
 98 G         ###
 97 G         ####
 96 T         ###
 95 G         #####
 94 A         ##
 93 T         ###
 92 A         ###
 91 C         ###
 90 G         ###
 89 C         ####
 88 G         ###
 87 A         ###
 86 A         ####
 85 A         ###
 84 T         ###
 83 C         ###
 82 C         ###
 81 T         ###
 80 A         ###
 79 T         ###
 78 C         #####
 77 A         ##
 76 C         ###
 75 C         ####
 74 G         ###
 73 C         #####
 72 A         ####
 71 A         ###
 70 G         ###
 69 G         ###
 68 G         ###
 67 A         ##
 66 T         ####
 65 A         ###
 64 C         ####
 63 C         ####
 62 G         ###
 61 G         ####
 60 T         ####
 59 A         ##
 58 T         ###
 57 C         ###
 56 C         ###
 55 C         ###
 54 T         ###
 53 T         ###
 52 G         ####
 51 C         ####
 50 G         ###
 49 G         ###
 48 T         ###
 47 G         ####
 46 A         ##
 45 T         ###
 44 A         ###
 43 G         ###
 42 G         ###
 41 G         ####
 40 G         ###
 39 T         ###
 38 A         ###
 37 T         ##
 36 C         ###
 35 C         ###
 34 C         ###
 33 T         ###
 32 T         ###
 31 G         ####
 30 C         ###
 29 G         ###
 28 G         ###
 27 T         ##
 26 G         ####
 25 A         ##
 24 T         ###
 23 A         ###
 22 G         ###
 21 G         ###
 20 G         ###
 19 G         ###
 18 T         ###
 17 A         ###
 16 T         ##
 15 C         ###
 14 A         ##
 13 C         ##
 12 C         ###
 11 G         ##
 10 C         ###
 9 G          ###
 8 G          ######


Length from nick
-56 A         #######
-55 G         
-54 T         ##########################
-53 G         
-52 A         #####
-51 A         ##
-50 T         ##
-49 T         ####
-48 G         ###
-47 T         ###
-46 A         ###########
-45 A         ##############
-44 T         ##################
-43 A         ################
-42 C         ###########################
-41 G         #####################################
-40 A         ####################
-39 C         #####################
-38 T         ####################
-37 C         ####################
-36 A         ########################
-35 C         #########
-34 T         ########
-33 A         #################
-32 T         ##########
-31 A         #######
-30 G         ###
-29 G         ####
-28 G         ##
-27 C         ##
-26 G         ###
-25 A         ###
-24 A         ##
-23 T         #
-22 T         #
-21 G         #
-20 G         ##
-19 G         #
-18 C         ##
-17 C         ###
-16 C         ###
-15 G         ###
-14 A         ##
-13 C         ###
-12 G         #####
-11 T         #######
-10 C         ########
-9 G          ################
-8 C          #############
-7 A          #############
-6 T          ################
-5 G          #########
-4 C          ###############
-3 T          ##########################################
-2 C          #############
-1 C          ####################################
 1 T          ###########################################
 2 C          ###################################################################################################
 3 T          #############################################
 4 A          ######################################
 5 G          ##########################
 6 A          ##############
 7 C          ##########################
 8 T          ##################
 9 C          ################
 10 G         #############
 11 A         ########
 12 G         #######
 13 G         ######
 14 A         ####
 15 A         #####
 16 T         ##
 17 T         ###
 18 C         ###
 19 G         
 20 G         #
 21 T         ###
 22 A         ##
 23 C         ###
 24 C         ##
 25 C         ##
 26 C         ##
 27 C         ##
 28 G         #
 29 T         ###
 30 A         ##
 31 T         ##
 32 C         ##
 33 A         ##
 34 C         ###
 35 C         ##
 36 G         #
 37 G         #
 38 C         ##
 39 G         
 40 G         ##
 41 T         ##
 42 G         ##
 43 A         ####
 44 T         ##
 45 A         ##
 46 C         ##
 47 G         ###
 48 A         ##
 49 A         #
 50 T         #
 51 T         ###
 52 C         ##
 53 G         ##
 54 T         ##
 55 A         ##
 56 T         ##
 57 C         ##
 58 C         ##
 59 C         ##
 60 T         ##
 61 T         ##
 62 C         ####
 63 G         ##
 64 G         ##
 65 T         ##
 66 G         ###
 67 A         ###
 68 T         ##
 69 A         ##
 70 C         ###
 71 G         ###
 72 C         ##
 73 T         ##
 74 A         ###
 75 G         ##
 76 G         ###
 77 G         ###
 78 G         ###
 79 T         ##
 80 T         ###
 81 C         #
 82 G         ######
 83 C         ###
 84 G         ###
 85 T         ###
 86 A         ###
 87 T         ###
 88 C         ###
 89 A         ##
 90 C         ####
 91 C         ####
 92 G         ###
 93 C         ###
 94 C         ####
 95 G         ###
 96 G         ####
 97 T         ###
 98 G         #####
 99 A         ##
 100 T        ###
 101 A        ###
 102 C        ###
 103 G        ###
 104 C        ####
 105 G        ###
 106 A        ###
 107 A        ####
 108 A        ###
 109 T        ###
 110 C        ###
 111 C        ###
 112 T        ###
 113 A        ###
 114 T        ###
 115 C        #####
 116 A        ##
 117 C        ###
 118 C        ####
 119 G        ###
 120 C        #####
 121 A        ####
 122 A        ###
 123 G        ###
 124 G        ###
 125 G        ###
 126 A        ##
 127 T        ####
 128 A        ###
 129 C        ####
 130 C        ####
 131 G        ###
 132 G        ####
 133 T        ####
 134 A        ##
 135 T        ###
 136 C        ###
 137 C        ###
 138 C        ###
 139 T        ###
 140 T        ###
 141 G        ####
 142 C        ####
 143 G        ###
 144 G        ###
 145 T        ###
 146 G        ####
 147 A        ##
 148 T        ###
 149 A        ###
 150 G        ###
 151 G        ###
 152 G        ####
 153 G        ###
 154 T        ###
 155 A        ###
 156 T        ##
 157 C        ###
 158 C        ###
 159 C        ###
 160 T        ###
 161 T        ###
 162 G        ####
 163 C        ###
 164 G        ###
 165 G        ###
 166 T        ##
 167 G        ####
 168 A        ##
 169 T        ###
 170 A        ###
 171 G        ###
 172 G        ###
 173 G        ###
 174 G        ###
 175 T        ###
 176 A        ###
 177 T        ##
 178 C        ###
 179 A        ##
 180 C        ##
 181 C        ###
 182 G        ##
 183 C        ###
 184 G        ###
 185 G        ######


Name of gel and number of scan = No65 def.193 - 16 sec
Name of sequence = Clon No 1670
Number of lanes =  11 
Lane for analysis =  6 
Number of analysing nucleotide =  241 
First analysing nucleotide =  142 
3'-nucleotide before nik =  197 
5'-AGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTGTAATACGACTCACTATAGGGCGAATTGGGCCCGACGTCGCATGCTCCTCTAGACTCGAGGAATTCGGTACCCCCGTATCACCGGCGGTGATACGAATTCGTATCCCTTCGGTGATACGCTAGGGGTTCGCGTATCACCGCCGGTGATACGCGAAATCCTATCACCGCAAGGGATACCGGTATCCCTTGCGGTGATAGGGGTATCCCTTGCGGTGATAGGGGTATCACCGCGGTGATAGG0
Length of fragment =  389   P(K)=P(K)/100

 142 A 1295 
 143 G 569 
 144 T 743 
 145 G 626 
 146 A 881 
 147 A 773 
 148 T 839 
 149 T 1028 
 150 G 1181 
 151 T 1406 
 152 A 1610 
 153 A 2464 
 154 T 3195 
 155 A 3259 
 156 C 4691 
 157 G 4399 
 158 A 4678 
 159 C 3421 
 160 T 3434 
 161 C 2777 
 162 A 2975 
 163 C 2487 
 164 T 2451 
 165 A 2193 
 166 T 1870 
 167 A 1575 
 168 G 1174 
 169 G 1105 
 170 G 938 
 171 C 864 
 172 G 695 
 173 A 572 
 174 A 500 
 175 T 543 
 176 T 475 
 177 G 642 
 178 G 416 
 179 G 663 
 180 C 537 
 181 C 580 
 182 C 582 
 183 G 693 
 184 A 901 
 185 C 840 
 186 G 1105 
 187 T 1130 
 188 C 1078 
 189 G 2237 
 190 C 2195 
 191 A 2456 
 192 T 2893 
 193 G 5021 
 194 C 5297 
 195 T 5008 
 196 C 5543 
 197 C 4867 
 198 T 6507 
 199 C 7352 
 200 T 6859 
 201 A 5915 
 202 G 5583 
 203 A 4053 
 204 C 3937 
 205 T 2520 
 206 C 2568 
 207 G 2447 
 208 A 2038 
 209 G 1771 
 210 G 1663 
 211 A 1460 
 212 A 970 
 213 T 930 
 214 T 802 
 215 C 678 
 216 G 685 
 217 G 505 
 218 T 342 
 219 A 284 
 220 C 469 
 221 C 453 
 222 C 532 
 223 C 582 
 224 C 534 
 225 G 477 
 226 T 571 
 227 A 553 
 228 T 445 
 229 C 445 
 230 A 460 
 231 C 449 
 232 C 447 
 233 G 470 
 234 G 452 
 235 C 473 
 236 G 512 
 237 G 487 
 238 T 453 
 239 G 303 
 240 A 376 
 241 T 535 
 242 A 523 
 243 C 420 
 244 G 456 
 245 A 449 
 246 A 429 
 247 T 390 
 248 T 429 
 249 C 428 
 250 G 457 
 251 T 464 
 252 A 444 
 253 T 455 
 254 C 475 
 255 C 478 
 256 C 458 
 257 T 491 
 258 T 466 
 259 C 557 
 260 G 527 
 261 G 508 
 262 T 496 
 263 G 517 
 264 A 482 
 265 T 529 
 266 A 521 
 267 C 553 
 268 G 493 
 269 C 561 
 270 T 460 
 271 A 512 
 272 G 525 
 273 G 552 
 274 G 558 
 275 G 516 
 276 T 546 
 277 T 530 
 278 C 397 
 279 G 775 
 280 C 635 
 281 G 585 
 282 T 573 
 283 A 544 
 284 T 539 
 285 C 606 
 286 A 562 
 287 C 607 
 288 C 653 
 289 G 605 
 290 C 624 
 291 C 690 
 292 G 752 
 293 G 698 
 294 T 683 
 295 G 814 
 296 A 472 
 297 T 658 
 298 A 640 
 299 C 698 
 300 G 698 
 301 C 688 
 302 G 621 
 303 A 600 
 304 A 644 
 305 A 583 
 306 T 586 
 307 C 611 
 308 C 657 
 309 T 614 
 310 A 638 
 311 T 661 
 312 C 728 
 313 A 564 
 314 C 657 
 315 C 780 
 316 G 697 
 317 C 777 
 318 A 599 
 319 A 650 
 320 G 640 
 321 G 664 
 322 G 668 
 323 A 566 
 324 T 635 
 325 A 581 
 326 C 673 
 327 C 727 
 328 G 649 
 329 G 642 
 330 T 641 
 331 A 568 
 332 T 614 
 333 C 642 
 334 C 613 
 335 C 651 
 336 T 626 
 337 T 593 
 338 G 712 
 339 C 695 
 340 G 661 
 341 G 649 
 342 T 579 
 343 G 669 
 344 A 538 
 345 T 568 
 346 A 581 
 347 G 601 
 348 G 611 
 349 G 592 
 350 G 605 
 351 T 610 
 352 A 523 
 353 T 551 
 354 C 599 
 355 C 528 
 356 C 573 
 357 T 582 
 358 T 556 
 359 G 624 
 360 C 626 
 361 G 593 
 362 G 566 
 363 T 531 
 364 G 639 
 365 A 463 
 366 T 534 
 367 A 554 
 368 G 593 
 369 G 581 
 370 G 586 
 371 G 575 
 372 T 544 
 373 A 541 
 374 T 522 
 375 C 529 
 376 A 477 
 377 C 464 
 378 C 539 
 379 G 484 
 380 C 534 
 381 G 580 
 382 G 736 

MAX = 7352    MIN = 284 

Length from 5'-end
 142 A        #############
 143 G        ###
 144 T        ######
 145 G        ####
 146 A        ########
 147 A        ######
 148 T        #######
 149 T        ##########
 150 G        ############
 151 T        ###############
 152 A        ##################
 153 A        #############################
 154 T        #######################################
 155 A        ########################################
 156 C        ###########################################################
 157 G        #######################################################
 158 A        ###########################################################
 159 C        ##########################################
 160 T        ##########################################
 161 C        #################################
 162 A        ####################################
 163 C        #############################
 164 T        #############################
 165 A        #########################
 166 T        #####################
 167 A        #################
 168 G        ############
 169 G        ###########
 170 G        ########
 171 C        #######
 172 G        #####
 173 A        ###
 174 A        ##
 175 T        ###
 176 T        ##
 177 G        ####
 178 G        #
 179 G        #####
 180 C        ###
 181 C        ####
 182 C        ####
 183 G        #####
 184 A        ########
 185 C        #######
 186 G        ###########
 187 T        ###########
 188 C        ##########
 189 G        ##########################
 190 C        #########################
 191 A        #############################
 192 T        ###################################
 193 G        ################################################################
 194 C        ####################################################################
 195 T        ################################################################
 196 C        #######################################################################
 197 C        ##############################################################
 198 T        ####################################################################################
 199 C        ################################################################################################
 200 T        #########################################################################################
 201 A        ############################################################################
 202 G        ########################################################################
 203 A        ###################################################
 204 C        #################################################
 205 T        ##############################
 206 C        ###############################
 207 G        #############################
 208 A        #######################
 209 G        ####################
 210 G        ##################
 211 A        ###############
 212 A        #########
 213 T        ########
 214 T        #######
 215 C        #####
 216 G        #####
 217 G        ###
 218 T        
 219 A        
 220 C        ##
 221 C        ##
 222 C        ###
 223 C        ####
 224 C        ###
 225 G        ##
 226 T        ###
 227 A        ###
 228 T        ##
 229 C        ##
 230 A        ##
 231 C        ##
 232 C        ##
 233 G        ##
 234 G        ##
 235 C        ##
 236 G        ###
 237 G        ##
 238 T        ##
 239 G        
 240 A        #
 241 T        ###
 242 A        ###
 243 C        #
 244 G        ##
 245 A        ##
 246 A        #
 247 T        #
 248 T        #
 249 C        #
 250 G        ##
 251 T        ##
 252 A        ##
 253 T        ##
 254 C        ##
 255 C        ##
 256 C        ##
 257 T        ##
 258 T        ##
 259 C        ###
 260 G        ###
 261 G        ###
 262 T        ##
 263 G        ###
 264 A        ##
 265 T        ###
 266 A        ###
 267 C        ###
 268 G        ##
 269 C        ###
 270 T        ##
 271 A        ###
 272 G        ###
 273 G        ###
 274 G        ###
 275 G        ###
 276 T        ###
 277 T        ###
 278 C        #
 279 G        ######
 280 C        ####
 281 G        ####
 282 T        ###
 283 A        ###
 284 T        ###
 285 C        ####
 286 A        ###
 287 C        ####
 288 C        #####
 289 G        ####
 290 C        ####
 291 C        #####
 292 G        ######
 293 G        #####
 294 T        #####
 295 G        #######
 296 A        ##
 297 T        #####
 298 A        ####
 299 C        #####
 300 G        #####
 301 C        #####
 302 G        ####
 303 A        ####
 304 A        ####
 305 A        ####
 306 T        ####
 307 C        ####
 308 C        #####
 309 T        ####
 310 A        ####
 311 T        #####
 312 C        ######
 313 A        ###
 314 C        #####
 315 C        ######
 316 G        #####
 317 C        ######
 318 A        ####
 319 A        ####
 320 G        ####
 321 G        #####
 322 G        #####
 323 A        ###
 324 T        ####
 325 A        ####
 326 C        #####
 327 C        ######
 328 G        ####
 329 G        ####
 330 T        ####
 331 A        ###
 332 T        ####
 333 C        ####
 334 C        ####
 335 C        ####
 336 T        ####
 337 T        ####
 338 G        #####
 339 C        #####
 340 G        #####
 341 G        ####
 342 T        ####
 343 G        #####
 344 A        ###
 345 T        ###
 346 A        ####
 347 G        ####
 348 G        ####
 349 G        ####
 350 G        ####
 351 T        ####
 352 A        ###
 353 T        ###
 354 C        ####
 355 C        ###
 356 C        ###
 357 T        ####
 358 T        ###
 359 G        ####
 360 C        ####
 361 G        ####
 362 G        ###
 363 T        ###
 364 G        ####
 365 A        ##
 366 T        ###
 367 A        ###
 368 G        ####
 369 G        ####
 370 G        ####
 371 G        ###
 372 T        ###
 373 A        ###
 374 T        ###
 375 C        ###
 376 A        ##
 377 C        ##
 378 C        ###
 379 G        ##
 380 C        ###
 381 G        ####
 382 G        ######


Length from 3'-end
 248 A        #############
 247 G        ###
 246 T        ######
 245 G        ####
 244 A        ########
 243 A        ######
 242 T        #######
 241 T        ##########
 240 G        ############
 239 T        ###############
 238 A        ##################
 237 A        #############################
 236 T        #######################################
 235 A        ########################################
 234 C        ###########################################################
 233 G        #######################################################
 232 A        ###########################################################
 231 C        ##########################################
 230 T        ##########################################
 229 C        #################################
 228 A        ####################################
 227 C        #############################
 226 T        #############################
 225 A        #########################
 224 T        #####################
 223 A        #################
 222 G        ############
 221 G        ###########
 220 G        ########
 219 C        #######
 218 G        #####
 217 A        ###
 216 A        ##
 215 T        ###
 214 T        ##
 213 G        ####
 212 G        #
 211 G        #####
 210 C        ###
 209 C        ####
 208 C        ####
 207 G        #####
 206 A        ########
 205 C        #######
 204 G        ###########
 203 T        ###########
 202 C        ##########
 201 G        ##########################
 200 C        #########################
 199 A        #############################
 198 T        ###################################
 197 G        ################################################################
 196 C        ####################################################################
 195 T        ################################################################
 194 C        #######################################################################
 193 C        ##############################################################
 192 T        ####################################################################################
 191 C        ################################################################################################
 190 T        #########################################################################################
 189 A        ############################################################################
 188 G        ########################################################################
 187 A        ###################################################
 186 C        #################################################
 185 T        ##############################
 184 C        ###############################
 183 G        #############################
 182 A        #######################
 181 G        ####################
 180 G        ##################
 179 A        ###############
 178 A        #########
 177 T        ########
 176 T        #######
 175 C        #####
 174 G        #####
 173 G        ###
 172 T        
 171 A        
 170 C        ##
 169 C        ##
 168 C        ###
 167 C        ####
 166 C        ###
 165 G        ##
 164 T        ###
 163 A        ###
 162 T        ##
 161 C        ##
 160 A        ##
 159 C        ##
 158 C        ##
 157 G        ##
 156 G        ##
 155 C        ##
 154 G        ###
 153 G        ##
 152 T        ##
 151 G        
 150 A        #
 149 T        ###
 148 A        ###
 147 C        #
 146 G        ##
 145 A        ##
 144 A        #
 143 T        #
 142 T        #
 141 C        #
 140 G        ##
 139 T        ##
 138 A        ##
 137 T        ##
 136 C        ##
 135 C        ##
 134 C        ##
 133 T        ##
 132 T        ##
 131 C        ###
 130 G        ###
 129 G        ###
 128 T        ##
 127 G        ###
 126 A        ##
 125 T        ###
 124 A        ###
 123 C        ###
 122 G        ##
 121 C        ###
 120 T        ##
 119 A        ###
 118 G        ###
 117 G        ###
 116 G        ###
 115 G        ###
 114 T        ###
 113 T        ###
 112 C        #
 111 G        ######
 110 C        ####
 109 G        ####
 108 T        ###
 107 A        ###
 106 T        ###
 105 C        ####
 104 A        ###
 103 C        ####
 102 C        #####
 101 G        ####
 100 C        ####
 99 C         #####
 98 G         ######
 97 G         #####
 96 T         #####
 95 G         #######
 94 A         ##
 93 T         #####
 92 A         ####
 91 C         #####
 90 G         #####
 89 C         #####
 88 G         ####
 87 A         ####
 86 A         ####
 85 A         ####
 84 T         ####
 83 C         ####
 82 C         #####
 81 T         ####
 80 A         ####
 79 T         #####
 78 C         ######
 77 A         ###
 76 C         #####
 75 C         ######
 74 G         #####
 73 C         ######
 72 A         ####
 71 A         ####
 70 G         ####
 69 G         #####
 68 G         #####
 67 A         ###
 66 T         ####
 65 A         ####
 64 C         #####
 63 C         ######
 62 G         ####
 61 G         ####
 60 T         ####
 59 A         ###
 58 T         ####
 57 C         ####
 56 C         ####
 55 C         ####
 54 T         ####
 53 T         ####
 52 G         #####
 51 C         #####
 50 G         #####
 49 G         ####
 48 T         ####
 47 G         #####
 46 A         ###
 45 T         ###
 44 A         ####
 43 G         ####
 42 G         ####
 41 G         ####
 40 G         ####
 39 T         ####
 38 A         ###
 37 T         ###
 36 C         ####
 35 C         ###
 34 C         ###
 33 T         ####
 32 T         ###
 31 G         ####
 30 C         ####
 29 G         ####
 28 G         ###
 27 T         ###
 26 G         ####
 25 A         ##
 24 T         ###
 23 A         ###
 22 G         ####
 21 G         ####
 20 G         ####
 19 G         ###
 18 T         ###
 17 A         ###
 16 T         ###
 15 C         ###
 14 A         ##
 13 C         ##
 12 C         ###
 11 G         ##
 10 C         ###
 9 G          ####
 8 G          ######


Length from nick
-56 A         #############
-55 G         ###
-54 T         ######
-53 G         ####
-52 A         ########
-51 A         ######
-50 T         #######
-49 T         ##########
-48 G         ############
-47 T         ###############
-46 A         ##################
-45 A         #############################
-44 T         #######################################
-43 A         ########################################
-42 C         ###########################################################
-41 G         #######################################################
-40 A         ###########################################################
-39 C         ##########################################
-38 T         ##########################################
-37 C         #################################
-36 A         ####################################
-35 C         #############################
-34 T         #############################
-33 A         #########################
-32 T         #####################
-31 A         #################
-30 G         ############
-29 G         ###########
-28 G         ########
-27 C         #######
-26 G         #####
-25 A         ###
-24 A         ##
-23 T         ###
-22 T         ##
-21 G         ####
-20 G         #
-19 G         #####
-18 C         ###
-17 C         ####
-16 C         ####
-15 G         #####
-14 A         ########
-13 C         #######
-12 G         ###########
-11 T         ###########
-10 C         ##########
-9 G          ##########################
-8 C          #########################
-7 A          #############################
-6 T          ###################################
-5 G          ################################################################
-4 C          ####################################################################
-3 T          ################################################################
-2 C          #######################################################################
-1 C          ##############################################################
 1 T          ####################################################################################
 2 C          ################################################################################################
 3 T          #########################################################################################
 4 A          ############################################################################
 5 G          ########################################################################
 6 A          ###################################################
 7 C          #################################################
 8 T          ##############################
 9 C          ###############################
 10 G         #############################
 11 A         #######################
 12 G         ####################
 13 G         ##################
 14 A         ###############
 15 A         #########
 16 T         ########
 17 T         #######
 18 C         #####
 19 G         #####
 20 G         ###
 21 T         
 22 A         
 23 C         ##
 24 C         ##
 25 C         ###
 26 C         ####
 27 C         ###
 28 G         ##
 29 T         ###
 30 A         ###
 31 T         ##
 32 C         ##
 33 A         ##
 34 C         ##
 35 C         ##
 36 G         ##
 37 G         ##
 38 C         ##
 39 G         ###
 40 G         ##
 41 T         ##
 42 G         
 43 A         #
 44 T         ###
 45 A         ###
 46 C         #
 47 G         ##
 48 A         ##
 49 A         #
 50 T         #
 51 T         #
 52 C         #
 53 G         ##
 54 T         ##
 55 A         ##
 56 T         ##
 57 C         ##
 58 C         ##
 59 C         ##
 60 T         ##
 61 T         ##
 62 C         ###
 63 G         ###
 64 G         ###
 65 T         ##
 66 G         ###
 67 A         ##
 68 T         ###
 69 A         ###
 70 C         ###
 71 G         ##
 72 C         ###
 73 T         ##
 74 A         ###
 75 G         ###
 76 G         ###
 77 G         ###
 78 G         ###
 79 T         ###
 80 T         ###
 81 C         #
 82 G         ######
 83 C         ####
 84 G         ####
 85 T         ###
 86 A         ###
 87 T         ###
 88 C         ####
 89 A         ###
 90 C         ####
 91 C         #####
 92 G         ####
 93 C         ####
 94 C         #####
 95 G         ######
 96 G         #####
 97 T         #####
 98 G         #######
 99 A         ##
 100 T        #####
 101 A        ####
 102 C        #####
 103 G        #####
 104 C        #####
 105 G        ####
 106 A        ####
 107 A        ####
 108 A        ####
 109 T        ####
 110 C        ####
 111 C        #####
 112 T        ####
 113 A        ####
 114 T        #####
 115 C        ######
 116 A        ###
 117 C        #####
 118 C        ######
 119 G        #####
 120 C        ######
 121 A        ####
 122 A        ####
 123 G        ####
 124 G        #####
 125 G        #####
 126 A        ###
 127 T        ####
 128 A        ####
 129 C        #####
 130 C        ######
 131 G        ####
 132 G        ####
 133 T        ####
 134 A        ###
 135 T        ####
 136 C        ####
 137 C        ####
 138 C        ####
 139 T        ####
 140 T        ####
 141 G        #####
 142 C        #####
 143 G        #####
 144 G        ####
 145 T        ####
 146 G        #####
 147 A        ###
 148 T        ###
 149 A        ####
 150 G        ####
 151 G        ####
 152 G        ####
 153 G        ####
 154 T        ####
 155 A        ###
 156 T        ###
 157 C        ####
 158 C        ###
 159 C        ###
 160 T        ####
 161 T        ###
 162 G        ####
 163 C        ####
 164 G        ####
 165 G        ###
 166 T        ###
 167 G        ####
 168 A        ##
 169 T        ###
 170 A        ###
 171 G        ####
 172 G        ####
 173 G        ####
 174 G        ###
 175 T        ###
 176 A        ###
 177 T        ###
 178 C        ###
 179 A        ##
 180 C        ##
 181 C        ###
 182 G        ##
 183 C        ###
 184 G        ####
 185 G        ######


Name of gel and number of scan = No65 def.193 - 32 sec
Name of sequence = Clon No 1670
Number of lanes =  11 
Lane for analysis =  7 
Number of analysing nucleotide =  241 
First analysing nucleotide =  142 
3'-nucleotide before nik =  197 
5'-AGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTGTAATACGACTCACTATAGGGCGAATTGGGCCCGACGTCGCATGCTCCTCTAGACTCGAGGAATTCGGTACCCCCGTATCACCGGCGGTGATACGAATTCGTATCCCTTCGGTGATACGCTAGGGGTTCGCGTATCACCGCCGGTGATACGCGAAATCCTATCACCGCAAGGGATACCGGTATCCCTTGCGGTGATAGGGGTATCCCTTGCGGTGATAGGGGTATCACCGCGGTGATAGG0
Length of fragment =  389   P(K)=P(K)/100

 142 A 1421 
 143 G 579 
 144 T 722 
 145 G 658 
 146 A 683 
 147 A 759 
 148 T 727 
 149 T 651 
 150 G 1336 
 151 T 929 
 152 A 1761 
 153 A 2233 
 154 T 2905 
 155 A 2563 
 156 C 3134 
 157 G 3738 
 158 A 4122 
 159 C 3053 
 160 T 2814 
 161 C 2549 
 162 A 2277 
 163 C 2351 
 164 T 1963 
 165 A 2673 
 166 T 2798 
 167 A 2073 
 168 G 2007 
 169 G 1876 
 170 G 1387 
 171 C 1269 
 172 G 1217 
 173 A 769 
 174 A 590 
 175 T 531 
 176 T 388 
 177 G 606 
 178 G 653 
 179 G 649 
 180 C 762 
 181 C 671 
 182 C 535 
 183 G 742 
 184 A 943 
 185 C 1050 
 186 G 1060 
 187 T 1019 
 188 C 1144 
 189 G 2129 
 190 C 2093 
 191 A 2389 
 192 T 2537 
 193 G 4578 
 194 C 4463 
 195 T 4293 
 196 C 4854 
 197 C 4443 
 198 T 5986 
 199 C 6147 
 200 T 6316 
 201 A 5500 
 202 G 5188 
 203 A 3738 
 204 C 4257 
 205 T 3075 
 206 C 2935 
 207 G 3173 
 208 A 2993 
 209 G 3649 
 210 G 2581 
 211 A 2418 
 212 A 2236 
 213 T 1122 
 214 T 1482 
 215 C 1002 
 216 G 817 
 217 G 630 
 218 T 680 
 219 A 620 
 220 C 546 
 221 C 477 
 222 C 487 
 223 C 476 
 224 C 580 
 225 G 590 
 226 T 402 
 227 A 425 
 228 T 391 
 229 C 490 
 230 A 501 
 231 C 438 
 232 C 454 
 233 G 437 
 234 G 430 
 235 C 478 
 236 G 537 
 237 G 460 
 238 T 397 
 239 G 364 
 240 A 445 
 241 T 577 
 242 A 530 
 243 C 443 
 244 G 465 
 245 A 483 
 246 A 386 
 247 T 352 
 248 T 453 
 249 C 460 
 250 G 498 
 251 T 481 
 252 A 461 
 253 T 464 
 254 C 533 
 255 C 412 
 256 C 514 
 257 T 453 
 258 T 419 
 259 C 625 
 260 G 584 
 261 G 524 
 262 T 515 
 263 G 549 
 264 A 479 
 265 T 489 
 266 A 512 
 267 C 557 
 268 G 547 
 269 C 572 
 270 T 472 
 271 A 493 
 272 G 533 
 273 G 605 
 274 G 590 
 275 G 599 
 276 T 534 
 277 T 240 
 278 C 342 
 279 G 1135 
 280 C 650 
 281 G 642 
 282 T 603 
 283 A 528 
 284 T 587 
 285 C 647 
 286 A 535 
 287 C 640 
 288 C 726 
 289 G 614 
 290 C 670 
 291 C 704 
 292 G 700 
 293 G 671 
 294 T 99 
 295 G 484 
 296 A 989 
 297 T 1034 
 298 A 753 
 299 C 806 
 300 G 736 
 301 C 677 
 302 G 733 
 303 A 671 
 304 A 598 
 305 A 580 
 306 T 603 
 307 C 678 
 308 C 669 
 309 T 652 
 310 A 700 
 311 T 716 
 312 C 771 
 313 A 576 
 314 C 737 
 315 C 776 
 316 G 707 
 317 C 870 
 318 A 651 
 319 A 614 
 320 G 663 
 321 G 703 
 322 G 781 
 323 A 1035 
 324 T 544 
 325 A 623 
 326 C 645 
 327 C 765 
 328 G 680 
 329 G 710 
 330 T 713 
 331 A 586 
 332 T 637 
 333 C 632 
 334 C 675 
 335 C 687 
 336 T 670 
 337 T 619 
 338 G 738 
 339 C 760 
 340 G 701 
 341 G 704 
 342 T 630 
 343 G 735 
 344 A 560 
 345 T 625 
 346 A 591 
 347 G 645 
 348 G 634 
 349 G 685 
 350 G 611 
 351 T 675 
 352 A 560 
 353 T 584 
 354 C 621 
 355 C 580 
 356 C 574 
 357 T 617 
 358 T 616 
 359 G 677 
 360 C 676 
 361 G 647 
 362 G 593 
 363 T 559 
 364 G 722 
 365 A 522 
 366 T 568 
 367 A 577 
 368 G 646 
 369 G 622 
 370 G 656 
 371 G 619 
 372 T 573 
 373 A 622 
 374 T 548 
 375 C 654 
 376 A 539 
 377 C 517 
 378 C 603 
 379 G 546 
 380 C 570 
 381 G 662 
 382 G 973 

MAX = 6316    MIN = 99 

Length from 5'-end
 142 A        ####################
 143 G        #######
 144 T        #########
 145 G        ########
 146 A        #########
 147 A        ##########
 148 T        #########
 149 T        ########
 150 G        ###################
 151 T        #############
 152 A        ##########################
 153 A        #################################
 154 T        ############################################
 155 A        #######################################
 156 C        ################################################
 157 G        #########################################################
 158 A        ###############################################################
 159 C        ##############################################
 160 T        ##########################################
 161 C        ######################################
 162 A        ##################################
 163 C        ###################################
 164 T        #############################
 165 A        ########################################
 166 T        ##########################################
 167 A        ###############################
 168 G        ##############################
 169 G        ############################
 170 G        ####################
 171 C        ##################
 172 G        #################
 173 A        ##########
 174 A        #######
 175 T        ######
 176 T        ####
 177 G        ########
 178 G        ########
 179 G        ########
 180 C        ##########
 181 C        #########
 182 C        ######
 183 G        ##########
 184 A        #############
 185 C        ###############
 186 G        ###############
 187 T        ##############
 188 C        ################
 189 G        ################################
 190 C        ###############################
 191 A        ####################################
 192 T        ######################################
 193 G        ######################################################################
 194 C        #####################################################################
 195 T        ##################################################################
 196 C        ###########################################################################
 197 C        ####################################################################
 198 T        #############################################################################################
 199 C        ###############################################################################################
 200 T        ##################################################################################################
 201 A        #####################################################################################
 202 G        ################################################################################
 203 A        #########################################################
 204 C        #################################################################
 205 T        ###############################################
 206 C        ############################################
 207 G        ################################################
 208 A        #############################################
 209 G        ########################################################
 210 G        #######################################
 211 A        ####################################
 212 A        #################################
 213 T        ################
 214 T        #####################
 215 C        ##############
 216 G        ###########
 217 G        ########
 218 T        #########
 219 A        ########
 220 C        #######
 221 C        #####
 222 C        ######
 223 C        #####
 224 C        #######
 225 G        #######
 226 T        ####
 227 A        #####
 228 T        ####
 229 C        ######
 230 A        ######
 231 C        #####
 232 C        #####
 233 G        #####
 234 G        #####
 235 C        ######
 236 G        ######
 237 G        #####
 238 T        ####
 239 G        ####
 240 A        #####
 241 T        #######
 242 A        ######
 243 C        #####
 244 G        #####
 245 A        ######
 246 A        ####
 247 T        ####
 248 T        #####
 249 C        #####
 250 G        ######
 251 T        ######
 252 A        #####
 253 T        #####
 254 C        ######
 255 C        ####
 256 C        ######
 257 T        #####
 258 T        #####
 259 C        ########
 260 G        #######
 261 G        ######
 262 T        ######
 263 G        #######
 264 A        ######
 265 T        ######
 266 A        ######
 267 C        #######
 268 G        #######
 269 C        #######
 270 T        #####
 271 A        ######
 272 G        ######
 273 G        ########
 274 G        #######
 275 G        #######
 276 T        ######
 277 T        ##
 278 C        ###
 279 G        ################
 280 C        ########
 281 G        ########
 282 T        #######
 283 A        ######
 284 T        #######
 285 C        ########
 286 A        ######
 287 C        ########
 288 C        #########
 289 G        ########
 290 C        #########
 291 C        #########
 292 G        #########
 293 G        #########
 294 T        
 295 G        ######
 296 A        ##############
 297 T        ##############
 298 A        ##########
 299 C        ###########
 300 G        ##########
 301 C        #########
 302 G        ##########
 303 A        #########
 304 A        #######
 305 A        #######
 306 T        #######
 307 C        #########
 308 C        #########
 309 T        ########
 310 A        #########
 311 T        #########
 312 C        ##########
 313 A        #######
 314 C        ##########
 315 C        ##########
 316 G        #########
 317 C        ############
 318 A        ########
 319 A        ########
 320 G        ########
 321 G        #########
 322 G        ##########
 323 A        ##############
 324 T        #######
 325 A        ########
 326 C        ########
 327 C        ##########
 328 G        #########
 329 G        #########
 330 T        #########
 331 A        #######
 332 T        ########
 333 C        ########
 334 C        #########
 335 C        #########
 336 T        #########
 337 T        ########
 338 G        ##########
 339 C        ##########
 340 G        #########
 341 G        #########
 342 T        ########
 343 G        ##########
 344 A        #######
 345 T        ########
 346 A        #######
 347 G        ########
 348 G        ########
 349 G        #########
 350 G        ########
 351 T        #########
 352 A        #######
 353 T        #######
 354 C        ########
 355 C        #######
 356 C        #######
 357 T        ########
 358 T        ########
 359 G        #########
 360 C        #########
 361 G        ########
 362 G        #######
 363 T        #######
 364 G        #########
 365 A        ######
 366 T        #######
 367 A        #######
 368 G        ########
 369 G        ########
 370 G        ########
 371 G        ########
 372 T        #######
 373 A        ########
 374 T        #######
 375 C        ########
 376 A        ######
 377 C        ######
 378 C        #######
 379 G        #######
 380 C        #######
 381 G        ########
 382 G        #############


Length from 3'-end
 248 A        ####################
 247 G        #######
 246 T        #########
 245 G        ########
 244 A        #########
 243 A        ##########
 242 T        #########
 241 T        ########
 240 G        ###################
 239 T        #############
 238 A        ##########################
 237 A        #################################
 236 T        ############################################
 235 A        #######################################
 234 C        ################################################
 233 G        #########################################################
 232 A        ###############################################################
 231 C        ##############################################
 230 T        ##########################################
 229 C        ######################################
 228 A        ##################################
 227 C        ###################################
 226 T        #############################
 225 A        ########################################
 224 T        ##########################################
 223 A        ###############################
 222 G        ##############################
 221 G        ############################
 220 G        ####################
 219 C        ##################
 218 G        #################
 217 A        ##########
 216 A        #######
 215 T        ######
 214 T        ####
 213 G        ########
 212 G        ########
 211 G        ########
 210 C        ##########
 209 C        #########
 208 C        ######
 207 G        ##########
 206 A        #############
 205 C        ###############
 204 G        ###############
 203 T        ##############
 202 C        ################
 201 G        ################################
 200 C        ###############################
 199 A        ####################################
 198 T        ######################################
 197 G        ######################################################################
 196 C        #####################################################################
 195 T        ##################################################################
 194 C        ###########################################################################
 193 C        ####################################################################
 192 T        #############################################################################################
 191 C        ###############################################################################################
 190 T        ##################################################################################################
 189 A        #####################################################################################
 188 G        ################################################################################
 187 A        #########################################################
 186 C        #################################################################
 185 T        ###############################################
 184 C        ############################################
 183 G        ################################################
 182 A        #############################################
 181 G        ########################################################
 180 G        #######################################
 179 A        ####################################
 178 A        #################################
 177 T        ################
 176 T        #####################
 175 C        ##############
 174 G        ###########
 173 G        ########
 172 T        #########
 171 A        ########
 170 C        #######
 169 C        #####
 168 C        ######
 167 C        #####
 166 C        #######
 165 G        #######
 164 T        ####
 163 A        #####
 162 T        ####
 161 C        ######
 160 A        ######
 159 C        #####
 158 C        #####
 157 G        #####
 156 G        #####
 155 C        ######
 154 G        ######
 153 G        #####
 152 T        ####
 151 G        ####
 150 A        #####
 149 T        #######
 148 A        ######
 147 C        #####
 146 G        #####
 145 A        ######
 144 A        ####
 143 T        ####
 142 T        #####
 141 C        #####
 140 G        ######
 139 T        ######
 138 A        #####
 137 T        #####
 136 C        ######
 135 C        ####
 134 C        ######
 133 T        #####
 132 T        #####
 131 C        ########
 130 G        #######
 129 G        ######
 128 T        ######
 127 G        #######
 126 A        ######
 125 T        ######
 124 A        ######
 123 C        #######
 122 G        #######
 121 C        #######
 120 T        #####
 119 A        ######
 118 G        ######
 117 G        ########
 116 G        #######
 115 G        #######
 114 T        ######
 113 T        ##
 112 C        ###
 111 G        ################
 110 C        ########
 109 G        ########
 108 T        #######
 107 A        ######
 106 T        #######
 105 C        ########
 104 A        ######
 103 C        ########
 102 C        #########
 101 G        ########
 100 C        #########
 99 C         #########
 98 G         #########
 97 G         #########
 96 T         
 95 G         ######
 94 A         ##############
 93 T         ##############
 92 A         ##########
 91 C         ###########
 90 G         ##########
 89 C         #########
 88 G         ##########
 87 A         #########
 86 A         #######
 85 A         #######
 84 T         #######
 83 C         #########
 82 C         #########
 81 T         ########
 80 A         #########
 79 T         #########
 78 C         ##########
 77 A         #######
 76 C         ##########
 75 C         ##########
 74 G         #########
 73 C         ############
 72 A         ########
 71 A         ########
 70 G         ########
 69 G         #########
 68 G         ##########
 67 A         ##############
 66 T         #######
 65 A         ########
 64 C         ########
 63 C         ##########
 62 G         #########
 61 G         #########
 60 T         #########
 59 A         #######
 58 T         ########
 57 C         ########
 56 C         #########
 55 C         #########
 54 T         #########
 53 T         ########
 52 G         ##########
 51 C         ##########
 50 G         #########
 49 G         #########
 48 T         ########
 47 G         ##########
 46 A         #######
 45 T         ########
 44 A         #######
 43 G         ########
 42 G         ########
 41 G         #########
 40 G         ########
 39 T         #########
 38 A         #######
 37 T         #######
 36 C         ########
 35 C         #######
 34 C         #######
 33 T         ########
 32 T         ########
 31 G         #########
 30 C         #########
 29 G         ########
 28 G         #######
 27 T         #######
 26 G         #########
 25 A         ######
 24 T         #######
 23 A         #######
 22 G         ########
 21 G         ########
 20 G         ########
 19 G         ########
 18 T         #######
 17 A         ########
 16 T         #######
 15 C         ########
 14 A         ######
 13 C         ######
 12 C         #######
 11 G         #######
 10 C         #######
 9 G          ########
 8 G          #############


Length from nick
-56 A         ####################
-55 G         #######
-54 T         #########
-53 G         ########
-52 A         #########
-51 A         ##########
-50 T         #########
-49 T         ########
-48 G         ###################
-47 T         #############
-46 A         ##########################
-45 A         #################################
-44 T         ############################################
-43 A         #######################################
-42 C         ################################################
-41 G         #########################################################
-40 A         ###############################################################
-39 C         ##############################################
-38 T         ##########################################
-37 C         ######################################
-36 A         ##################################
-35 C         ###################################
-34 T         #############################
-33 A         ########################################
-32 T         ##########################################
-31 A         ###############################
-30 G         ##############################
-29 G         ############################
-28 G         ####################
-27 C         ##################
-26 G         #################
-25 A         ##########
-24 A         #######
-23 T         ######
-22 T         ####
-21 G         ########
-20 G         ########
-19 G         ########
-18 C         ##########
-17 C         #########
-16 C         ######
-15 G         ##########
-14 A         #############
-13 C         ###############
-12 G         ###############
-11 T         ##############
-10 C         ################
-9 G          ################################
-8 C          ###############################
-7 A          ####################################
-6 T          ######################################
-5 G          ######################################################################
-4 C          #####################################################################
-3 T          ##################################################################
-2 C          ###########################################################################
-1 C          ####################################################################
 1 T          #############################################################################################
 2 C          ###############################################################################################
 3 T          ##################################################################################################
 4 A          #####################################################################################
 5 G          ################################################################################
 6 A          #########################################################
 7 C          #################################################################
 8 T          ###############################################
 9 C          ############################################
 10 G         ################################################
 11 A         #############################################
 12 G         ########################################################
 13 G         #######################################
 14 A         ####################################
 15 A         #################################
 16 T         ################
 17 T         #####################
 18 C         ##############
 19 G         ###########
 20 G         ########
 21 T         #########
 22 A         ########
 23 C         #######
 24 C         #####
 25 C         ######
 26 C         #####
 27 C         #######
 28 G         #######
 29 T         ####
 30 A         #####
 31 T         ####
 32 C         ######
 33 A         ######
 34 C         #####
 35 C         #####
 36 G         #####
 37 G         #####
 38 C         ######
 39 G         ######
 40 G         #####
 41 T         ####
 42 G         ####
 43 A         #####
 44 T         #######
 45 A         ######
 46 C         #####
 47 G         #####
 48 A         ######
 49 A         ####
 50 T         ####
 51 T         #####
 52 C         #####
 53 G         ######
 54 T         ######
 55 A         #####
 56 T         #####
 57 C         ######
 58 C         ####
 59 C         ######
 60 T         #####
 61 T         #####
 62 C         ########
 63 G         #######
 64 G         ######
 65 T         ######
 66 G         #######
 67 A         ######
 68 T         ######
 69 A         ######
 70 C         #######
 71 G         #######
 72 C         #######
 73 T         #####
 74 A         ######
 75 G         ######
 76 G         ########
 77 G         #######
 78 G         #######
 79 T         ######
 80 T         ##
 81 C         ###
 82 G         ################
 83 C         ########
 84 G         ########
 85 T         #######
 86 A         ######
 87 T         #######
 88 C         ########
 89 A         ######
 90 C         ########
 91 C         #########
 92 G         ########
 93 C         #########
 94 C         #########
 95 G         #########
 96 G         #########
 97 T         
 98 G         ######
 99 A         ##############
 100 T        ##############
 101 A        ##########
 102 C        ###########
 103 G        ##########
 104 C        #########
 105 G        ##########
 106 A        #########
 107 A        #######
 108 A        #######
 109 T        #######
 110 C        #########
 111 C        #########
 112 T        ########
 113 A        #########
 114 T        #########
 115 C        ##########
 116 A        #######
 117 C        ##########
 118 C        ##########
 119 G        #########
 120 C        ############
 121 A        ########
 122 A        ########
 123 G        ########
 124 G        #########
 125 G        ##########
 126 A        ##############
 127 T        #######
 128 A        ########
 129 C        ########
 130 C        ##########
 131 G        #########
 132 G        #########
 133 T        #########
 134 A        #######
 135 T        ########
 136 C        ########
 137 C        #########
 138 C        #########
 139 T        #########
 140 T        ########
 141 G        ##########
 142 C        ##########
 143 G        #########
 144 G        #########
 145 T        ########
 146 G        ##########
 147 A        #######
 148 T        ########
 149 A        #######
 150 G        ########
 151 G        ########
 152 G        #########
 153 G        ########
 154 T        #########
 155 A        #######
 156 T        #######
 157 C        ########
 158 C        #######
 159 C        #######
 160 T        ########
 161 T        ########
 162 G        #########
 163 C        #########
 164 G        ########
 165 G        #######
 166 T        #######
 167 G        #########
 168 A        ######
 169 T        #######
 170 A        #######
 171 G        ########
 172 G        ########
 173 G        ########
 174 G        ########
 175 T        #######
 176 A        ########
 177 T        #######
 178 C        ########
 179 A        ######
 180 C        ######
 181 C        #######
 182 G        #######
 183 C        #######
 184 G        ########
 185 G        #############


Name of gel and number of scan = No65 def.193 - 1 min
Name of sequence = Clon No 1670
Number of lanes =  11 
Lane for analysis =  8 
Number of analysing nucleotide =  241 
First analysing nucleotide =  142 
3'-nucleotide before nik =  197 
5'-AGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTGTAATACGACTCACTATAGGGCGAATTGGGCCCGACGTCGCATGCTCCTCTAGACTCGAGGAATTCGGTACCCCCGTATCACCGGCGGTGATACGAATTCGTATCCCTTCGGTGATACGCTAGGGGTTCGCGTATCACCGCCGGTGATACGCGAAATCCTATCACCGCAAGGGATACCGGTATCCCTTGCGGTGATAGGGGTATCCCTTGCGGTGATAGGGGTATCACCGCGGTGATAGG0
Length of fragment =  389   P(K)=P(K)/100

 142 A 1207 
 143 G 327 
 144 T 407 
 145 G 484 
 146 A 402 
 147 A 497 
 148 T 419 
 149 T 258 
 150 G 826 
 151 T 522 
 152 A 595 
 153 A 1019 
 154 T 1478 
 155 A 1616 
 156 C 1186 
 157 G 932 
 158 A 1156 
 159 C 1265 
 160 T 1188 
 161 C 1006 
 162 A 990 
 163 C 932 
 164 T 1119 
 165 A 1277 
 166 T 1011 
 167 A 474 
 168 G 798 
 169 G 609 
 170 G 648 
 171 C 367 
 172 G 432 
 173 A 326 
 174 A 403 
 175 T 432 
 176 T 272 
 177 G 357 
 178 G 399 
 179 G 682 
 180 C 339 
 181 C 331 
 182 C 447 
 183 G 694 
 184 A 351 
 185 C 205 
 186 G 611 
 187 T 924 
 188 C 802 
 189 G 745 
 190 C 1215 
 191 A 1183 
 192 T 1180 
 193 G 1974 
 194 C 2251 
 195 T 2089 
 196 C 2144 
 197 C 2167 
 198 T 2566 
 199 C 2355 
 200 T 2418 
 201 A 2510 
 202 G 2272 
 203 A 1651 
 204 C 1584 
 205 T 1204 
 206 C 1093 
 207 G 1448 
 208 A 725 
 209 G 831 
 210 G 948 
 211 A 928 
 212 A 826 
 213 T 518 
 214 T 527 
 215 C 306 
 216 G 449 
 217 G 370 
 218 T 311 
 219 A 320 
 220 C 447 
 221 C 270 
 222 C 292 
 223 C 307 
 224 C 308 
 225 G 335 
 226 T 294 
 227 A 300 
 228 T 220 
 229 C 214 
 230 A 223 
 231 C 344 
 232 C 314 
 233 G 268 
 234 G 252 
 235 C 317 
 236 G 331 
 237 G 259 
 238 T 303 
 239 G 294 
 240 A 315 
 241 T 341 
 242 A 298 
 243 C 250 
 244 G 190 
 245 A 321 
 246 A 393 
 247 T 327 
 248 T 320 
 249 C 315 
 250 G 307 
 251 T 274 
 252 A 302 
 253 T 273 
 254 C 309 
 255 C 323 
 256 C 388 
 257 T 311 
 258 T 371 
 259 C 326 
 260 G 394 
 261 G 361 
 262 T 324 
 263 G 361 
 264 A 310 
 265 T 317 
 266 A 368 
 267 C 336 
 268 G 366 
 269 C 388 
 270 T 245 
 271 A 405 
 272 G 397 
 273 G 382 
 274 G 403 
 275 G 342 
 276 T 333 
 277 T 246 
 278 C 227 
 279 G 590 
 280 C 365 
 281 G 456 
 282 T 401 
 283 A 377 
 284 T 381 
 285 C 400 
 286 A 360 
 287 C 455 
 288 C 504 
 289 G 415 
 290 C 440 
 291 C 513 
 292 G 456 
 293 G 436 
 294 T 335 
 295 G 147 
 296 A 592 
 297 T 688 
 298 A 480 
 299 C 561 
 300 G 552 
 301 C 459 
 302 G 475 
 303 A 474 
 304 A 380 
 305 A 416 
 306 T 387 
 307 C 497 
 308 C 512 
 309 T 431 
 310 A 428 
 311 T 504 
 312 C 507 
 313 A 331 
 314 C 433 
 315 C 535 
 316 G 448 
 317 C 510 
 318 A 452 
 319 A 449 
 320 G 509 
 321 G 465 
 322 G 480 
 323 A 421 
 324 T 423 
 325 A 465 
 326 C 504 
 327 C 461 
 328 G 443 
 329 G 460 
 330 T 488 
 331 A 414 
 332 T 388 
 333 C 438 
 334 C 451 
 335 C 437 
 336 T 344 
 337 T 450 
 338 G 497 
 339 C 448 
 340 G 462 
 341 G 423 
 342 T 406 
 343 G 465 
 344 A 359 
 345 T 370 
 346 A 437 
 347 G 456 
 348 G 409 
 349 G 438 
 350 G 400 
 351 T 451 
 352 A 366 
 353 T 360 
 354 C 434 
 355 C 394 
 356 C 456 
 357 T 334 
 358 T 371 
 359 G 427 
 360 C 463 
 361 G 495 
 362 G 394 
 363 T 402 
 364 G 469 
 365 A 345 
 366 T 373 
 367 A 418 
 368 G 414 
 369 G 472 
 370 G 428 
 371 G 457 
 372 T 352 
 373 A 407 
 374 T 349 
 375 C 421 
 376 A 341 
 377 C 348 
 378 C 348 
 379 G 323 
 380 C 390 
 381 G 467 
 382 G 826 

MAX = 2566    MIN = 147 

Length from 5'-end
 142 A        #########################################
 143 G        #######
 144 T        ##########
 145 G        #############
 146 A        #########
 147 A        #############
 148 T        ##########
 149 T        ####
 150 G        ##########################
 151 T        ##############
 152 A        #################
 153 A        #################################
 154 T        ###################################################
 155 A        #########################################################
 156 C        ########################################
 157 G        ##############################
 158 A        #######################################
 159 C        ###########################################
 160 T        ########################################
 161 C        #################################
 162 A        ################################
 163 C        ##############################
 164 T        #####################################
 165 A        ############################################
 166 T        #################################
 167 A        ############
 168 G        #########################
 169 G        ##################
 170 G        ###################
 171 C        ########
 172 G        ###########
 173 A        ######
 174 A        #########
 175 T        ###########
 176 T        ####
 177 G        ########
 178 G        #########
 179 G        ####################
 180 C        #######
 181 C        #######
 182 C        ###########
 183 G        #####################
 184 A        #######
 185 C        ##
 186 G        ##################
 187 T        ##############################
 188 C        #########################
 189 G        #######################
 190 C        #########################################
 191 A        ########################################
 192 T        ########################################
 193 G        #######################################################################
 194 C        #################################################################################
 195 T        ###########################################################################
 196 C        #############################################################################
 197 C        ##############################################################################
 198 T        ##############################################################################################
 199 C        ######################################################################################
 200 T        ########################################################################################
 201 A        ############################################################################################
 202 G        ##################################################################################
 203 A        ##########################################################
 204 C        ########################################################
 205 T        #########################################
 206 C        ####################################
 207 G        ##################################################
 208 A        ######################
 209 G        ##########################
 210 G        ###############################
 211 A        ##############################
 212 A        ##########################
 213 T        ##############
 214 T        ##############
 215 C        ######
 216 G        ###########
 217 G        ########
 218 T        ######
 219 A        ######
 220 C        ###########
 221 C        ####
 222 C        #####
 223 C        ######
 224 C        ######
 225 G        #######
 226 T        #####
 227 A        #####
 228 T        ##
 229 C        ##
 230 A        ##
 231 C        #######
 232 C        ######
 233 G        ####
 234 G        ####
 235 C        ######
 236 G        #######
 237 G        ####
 238 T        ######
 239 G        #####
 240 A        ######
 241 T        #######
 242 A        #####
 243 C        ####
 244 G        #
 245 A        ######
 246 A        #########
 247 T        #######
 248 T        ######
 249 C        ######
 250 G        ######
 251 T        ####
 252 A        ######
 253 T        ####
 254 C        ######
 255 C        ######
 256 C        #########
 257 T        ######
 258 T        ########
 259 C        ######
 260 G        #########
 261 G        ########
 262 T        ######
 263 G        ########
 264 A        ######
 265 T        ######
 266 A        ########
 267 C        #######
 268 G        ########
 269 C        #########
 270 T        ###
 271 A        ##########
 272 G        #########
 273 G        #########
 274 G        #########
 275 G        #######
 276 T        #######
 277 T        ###
 278 C        ###
 279 G        #################
 280 C        ########
 281 G        ############
 282 T        #########
 283 A        ########
 284 T        #########
 285 C        #########
 286 A        ########
 287 C        ############
 288 C        #############
 289 G        ##########
 290 C        ###########
 291 C        ##############
 292 G        ############
 293 G        ###########
 294 T        #######
 295 G        
 296 A        #################
 297 T        #####################
 298 A        ############
 299 C        ################
 300 G        ###############
 301 C        ############
 302 G        ############
 303 A        ############
 304 A        #########
 305 A        ##########
 306 T        #########
 307 C        #############
 308 C        ##############
 309 T        ###########
 310 A        ##########
 311 T        #############
 312 C        ##############
 313 A        #######
 314 C        ###########
 315 C        ###############
 316 G        ###########
 317 C        ##############
 318 A        ###########
 319 A        ###########
 320 G        ##############
 321 G        ############
 322 G        ############
 323 A        ##########
 324 T        ##########
 325 A        ############
 326 C        #############
 327 C        ############
 328 G        ###########
 329 G        ############
 330 T        #############
 331 A        ##########
 332 T        #########
 333 C        ###########
 334 C        ###########
 335 C        ###########
 336 T        #######
 337 T        ###########
 338 G        #############
 339 C        ###########
 340 G        ############
 341 G        ##########
 342 T        ##########
 343 G        ############
 344 A        ########
 345 T        ########
 346 A        ###########
 347 G        ############
 348 G        ##########
 349 G        ###########
 350 G        #########
 351 T        ###########
 352 A        ########
 353 T        ########
 354 C        ###########
 355 C        #########
 356 C        ############
 357 T        #######
 358 T        ########
 359 G        ##########
 360 C        ############
 361 G        #############
 362 G        #########
 363 T        #########
 364 G        ############
 365 A        #######
 366 T        ########
 367 A        ##########
 368 G        ##########
 369 G        ############
 370 G        ##########
 371 G        ############
 372 T        #######
 373 A        ##########
 374 T        #######
 375 C        ##########
 376 A        #######
 377 C        #######
 378 C        #######
 379 G        ######
 380 C        #########
 381 G        ############
 382 G        ##########################


Length from 3'-end
 248 A        #########################################
 247 G        #######
 246 T        ##########
 245 G        #############
 244 A        #########
 243 A        #############
 242 T        ##########
 241 T        ####
 240 G        ##########################
 239 T        ##############
 238 A        #################
 237 A        #################################
 236 T        ###################################################
 235 A        #########################################################
 234 C        ########################################
 233 G        ##############################
 232 A        #######################################
 231 C        ###########################################
 230 T        ########################################
 229 C        #################################
 228 A        ################################
 227 C        ##############################
 226 T        #####################################
 225 A        ############################################
 224 T        #################################
 223 A        ############
 222 G        #########################
 221 G        ##################
 220 G        ###################
 219 C        ########
 218 G        ###########
 217 A        ######
 216 A        #########
 215 T        ###########
 214 T        ####
 213 G        ########
 212 G        #########
 211 G        ####################
 210 C        #######
 209 C        #######
 208 C        ###########
 207 G        #####################
 206 A        #######
 205 C        ##
 204 G        ##################
 203 T        ##############################
 202 C        #########################
 201 G        #######################
 200 C        #########################################
 199 A        ########################################
 198 T        ########################################
 197 G        #######################################################################
 196 C        #################################################################################
 195 T        ###########################################################################
 194 C        #############################################################################
 193 C        ##############################################################################
 192 T        ##############################################################################################
 191 C        ######################################################################################
 190 T        ########################################################################################
 189 A        ############################################################################################
 188 G        ##################################################################################
 187 A        ##########################################################
 186 C        ########################################################
 185 T        #########################################
 184 C        ####################################
 183 G        ##################################################
 182 A        ######################
 181 G        ##########################
 180 G        ###############################
 179 A        ##############################
 178 A        ##########################
 177 T        ##############
 176 T        ##############
 175 C        ######
 174 G        ###########
 173 G        ########
 172 T        ######
 171 A        ######
 170 C        ###########
 169 C        ####
 168 C        #####
 167 C        ######
 166 C        ######
 165 G        #######
 164 T        #####
 163 A        #####
 162 T        ##
 161 C        ##
 160 A        ##
 159 C        #######
 158 C        ######
 157 G        ####
 156 G        ####
 155 C        ######
 154 G        #######
 153 G        ####
 152 T        ######
 151 G        #####
 150 A        ######
 149 T        #######
 148 A        #####
 147 C        ####
 146 G        #
 145 A        ######
 144 A        #########
 143 T        #######
 142 T        ######
 141 C        ######
 140 G        ######
 139 T        ####
 138 A        ######
 137 T        ####
 136 C        ######
 135 C        ######
 134 C        #########
 133 T        ######
 132 T        ########
 131 C        ######
 130 G        #########
 129 G        ########
 128 T        ######
 127 G        ########
 126 A        ######
 125 T        ######
 124 A        ########
 123 C        #######
 122 G        ########
 121 C        #########
 120 T        ###
 119 A        ##########
 118 G        #########
 117 G        #########
 116 G        #########
 115 G        #######
 114 T        #######
 113 T        ###
 112 C        ###
 111 G        #################
 110 C        ########
 109 G        ############
 108 T        #########
 107 A        ########
 106 T        #########
 105 C        #########
 104 A        ########
 103 C        ############
 102 C        #############
 101 G        ##########
 100 C        ###########
 99 C         ##############
 98 G         ############
 97 G         ###########
 96 T         #######
 95 G         
 94 A         #################
 93 T         #####################
 92 A         ############
 91 C         ################
 90 G         ###############
 89 C         ############
 88 G         ############
 87 A         ############
 86 A         #########
 85 A         ##########
 84 T         #########
 83 C         #############
 82 C         ##############
 81 T         ###########
 80 A         ##########
 79 T         #############
 78 C         ##############
 77 A         #######
 76 C         ###########
 75 C         ###############
 74 G         ###########
 73 C         ##############
 72 A         ###########
 71 A         ###########
 70 G         ##############
 69 G         ############
 68 G         ############
 67 A         ##########
 66 T         ##########
 65 A         ############
 64 C         #############
 63 C         ############
 62 G         ###########
 61 G         ############
 60 T         #############
 59 A         ##########
 58 T         #########
 57 C         ###########
 56 C         ###########
 55 C         ###########
 54 T         #######
 53 T         ###########
 52 G         #############
 51 C         ###########
 50 G         ############
 49 G         ##########
 48 T         ##########
 47 G         ############
 46 A         ########
 45 T         ########
 44 A         ###########
 43 G         ############
 42 G         ##########
 41 G         ###########
 40 G         #########
 39 T         ###########
 38 A         ########
 37 T         ########
 36 C         ###########
 35 C         #########
 34 C         ############
 33 T         #######
 32 T         ########
 31 G         ##########
 30 C         ############
 29 G         #############
 28 G         #########
 27 T         #########
 26 G         ############
 25 A         #######
 24 T         ########
 23 A         ##########
 22 G         ##########
 21 G         ############
 20 G         ##########
 19 G         ############
 18 T         #######
 17 A         ##########
 16 T         #######
 15 C         ##########
 14 A         #######
 13 C         #######
 12 C         #######
 11 G         ######
 10 C         #########
 9 G          ############
 8 G          ##########################


Length from nick
-56 A         #########################################
-55 G         #######
-54 T         ##########
-53 G         #############
-52 A         #########
-51 A         #############
-50 T         ##########
-49 T         ####
-48 G         ##########################
-47 T         ##############
-46 A         #################
-45 A         #################################
-44 T         ###################################################
-43 A         #########################################################
-42 C         ########################################
-41 G         ##############################
-40 A         #######################################
-39 C         ###########################################
-38 T         ########################################
-37 C         #################################
-36 A         ################################
-35 C         ##############################
-34 T         #####################################
-33 A         ############################################
-32 T         #################################
-31 A         ############
-30 G         #########################
-29 G         ##################
-28 G         ###################
-27 C         ########
-26 G         ###########
-25 A         ######
-24 A         #########
-23 T         ###########
-22 T         ####
-21 G         ########
-20 G         #########
-19 G         ####################
-18 C         #######
-17 C         #######
-16 C         ###########
-15 G         #####################
-14 A         #######
-13 C         ##
-12 G         ##################
-11 T         ##############################
-10 C         #########################
-9 G          #######################
-8 C          #########################################
-7 A          ########################################
-6 T          ########################################
-5 G          #######################################################################
-4 C          #################################################################################
-3 T          ###########################################################################
-2 C          #############################################################################
-1 C          ##############################################################################
 1 T          ##############################################################################################
 2 C          ######################################################################################
 3 T          ########################################################################################
 4 A          ############################################################################################
 5 G          ##################################################################################
 6 A          ##########################################################
 7 C          ########################################################
 8 T          #########################################
 9 C          ####################################
 10 G         ##################################################
 11 A         ######################
 12 G         ##########################
 13 G         ###############################
 14 A         ##############################
 15 A         ##########################
 16 T         ##############
 17 T         ##############
 18 C         ######
 19 G         ###########
 20 G         ########
 21 T         ######
 22 A         ######
 23 C         ###########
 24 C         ####
 25 C         #####
 26 C         ######
 27 C         ######
 28 G         #######
 29 T         #####
 30 A         #####
 31 T         ##
 32 C         ##
 33 A         ##
 34 C         #######
 35 C         ######
 36 G         ####
 37 G         ####
 38 C         ######
 39 G         #######
 40 G         ####
 41 T         ######
 42 G         #####
 43 A         ######
 44 T         #######
 45 A         #####
 46 C         ####
 47 G         #
 48 A         ######
 49 A         #########
 50 T         #######
 51 T         ######
 52 C         ######
 53 G         ######
 54 T         ####
 55 A         ######
 56 T         ####
 57 C         ######
 58 C         ######
 59 C         #########
 60 T         ######
 61 T         ########
 62 C         ######
 63 G         #########
 64 G         ########
 65 T         ######
 66 G         ########
 67 A         ######
 68 T         ######
 69 A         ########
 70 C         #######
 71 G         ########
 72 C         #########
 73 T         ###
 74 A         ##########
 75 G         #########
 76 G         #########
 77 G         #########
 78 G         #######
 79 T         #######
 80 T         ###
 81 C         ###
 82 G         #################
 83 C         ########
 84 G         ############
 85 T         #########
 86 A         ########
 87 T         #########
 88 C         #########
 89 A         ########
 90 C         ############
 91 C         #############
 92 G         ##########
 93 C         ###########
 94 C         ##############
 95 G         ############
 96 G         ###########
 97 T         #######
 98 G         
 99 A         #################
 100 T        #####################
 101 A        ############
 102 C        ################
 103 G        ###############
 104 C        ############
 105 G        ############
 106 A        ############
 107 A        #########
 108 A        ##########
 109 T        #########
 110 C        #############
 111 C        ##############
 112 T        ###########
 113 A        ##########
 114 T        #############
 115 C        ##############
 116 A        #######
 117 C        ###########
 118 C        ###############
 119 G        ###########
 120 C        ##############
 121 A        ###########
 122 A        ###########
 123 G        ##############
 124 G        ############
 125 G        ############
 126 A        ##########
 127 T        ##########
 128 A        ############
 129 C        #############
 130 C        ############
 131 G        ###########
 132 G        ############
 133 T        #############
 134 A        ##########
 135 T        #########
 136 C        ###########
 137 C        ###########
 138 C        ###########
 139 T        #######
 140 T        ###########
 141 G        #############
 142 C        ###########
 143 G        ############
 144 G        ##########
 145 T        ##########
 146 G        ############
 147 A        ########
 148 T        ########
 149 A        ###########
 150 G        ############
 151 G        ##########
 152 G        ###########
 153 G        #########
 154 T        ###########
 155 A        ########
 156 T        ########
 157 C        ###########
 158 C        #########
 159 C        ############
 160 T        #######
 161 T        ########
 162 G        ##########
 163 C        ############
 164 G        #############
 165 G        #########
 166 T        #########
 167 G        ############
 168 A        #######
 169 T        ########
 170 A        ##########
 171 G        ##########
 172 G        ############
 173 G        ##########
 174 G        ############
 175 T        #######
 176 A        ##########
 177 T        #######
 178 C        ##########
 179 A        #######
 180 C        #######
 181 C        #######
 182 G        ######
 183 C        #########
 184 G        ############
 185 G        ##########################


Name of gel and number of scan = No65 def.193 - 2 min
Name of sequence = Clon No 1670
Number of lanes =  11 
Lane for analysis =  9 
Number of analysing nucleotide =  241 
First analysing nucleotide =  142 
3'-nucleotide before nik =  197 
5'-AGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTGTAATACGACTCACTATAGGGCGAATTGGGCCCGACGTCGCATGCTCCTCTAGACTCGAGGAATTCGGTACCCCCGTATCACCGGCGGTGATACGAATTCGTATCCCTTCGGTGATACGCTAGGGGTTCGCGTATCACCGCCGGTGATACGCGAAATCCTATCACCGCAAGGGATACCGGTATCCCTTGCGGTGATAGGGGTATCCCTTGCGGTGATAGGGGTATCACCGCGGTGATAGG0
Length of fragment =  389   P(K)=P(K)/100

 142 A 5631 
 143 G 1581 
 144 T 1766 
 145 G 815 
 146 A 6211 
 147 A 17336 
 148 T 5305 
 149 T 2405 
 150 G 3466 
 151 T 11239 
 152 A 11332 
 153 A 17599 
 154 T 23732 
 155 A 23992 
 156 C 26797 
 157 G 25133 
 158 A 29049 
 159 C 24304 
 160 T 21737 
 161 C 16222 
 162 A 13218 
 163 C 13495 
 164 T 9539 
 165 A 10820 
 166 T 10006 
 167 A 8464 
 168 G 7296 
 169 G 5741 
 170 G 5251 
 171 C 5047 
 172 G 5230 
 173 A 4005 
 174 A 2794 
 175 T 2725 
 176 T 3721 
 177 G 4323 
 178 G 4047 
 179 G 4889 
 180 C 4247 
 181 C 4562 
 182 C 4803 
 183 G 5444 
 184 A 6848 
 185 C 6778 
 186 G 10710 
 187 T 12901 
 188 C 13665 
 189 G 21221 
 190 C 20800 
 191 A 24124 
 192 T 27646 
 193 G 43625 
 194 C 44122 
 195 T 40633 
 196 C 45511 
 197 C 43062 
 198 T 54985 
 199 C 54721 
 200 T 54347 
 201 A 46921 
 202 G 42959 
 203 A 32410 
 204 C 32354 
 205 T 21305 
 206 C 19521 
 207 G 16778 
 208 A 10407 
 209 G 11554 
 210 G 9972 
 211 A 8865 
 212 A 7740 
 213 T 5288 
 214 T 4938 
 215 C 3070 
 216 G 3685 
 217 G 3140 
 218 T 2594 
 219 A 2539 
 220 C 2201 
 221 C 2064 
 222 C 1904 
 223 C 1729 
 224 C 1800 
 225 G 2134 
 226 T 1687 
 227 A 1830 
 228 T 1820 
 229 C 1640 
 230 A 1873 
 231 C 1680 
 232 C 1821 
 233 G 1959 
 234 G 1968 
 235 C 2114 
 236 G 2240 
 237 G 2109 
 238 T 1953 
 239 G 2231 
 240 A 1926 
 241 T 1952 
 242 A 2022 
 243 C 1997 
 244 G 2146 
 245 A 1832 
 246 A 1897 
 247 T 1813 
 248 T 1861 
 249 C 2083 
 250 G 2346 
 251 T 2187 
 252 A 2298 
 253 T 2260 
 254 C 2299 
 255 C 2424 
 256 C 2680 
 257 T 2531 
 258 T 2580 
 259 C 3167 
 260 G 2735 
 261 G 2835 
 262 T 2771 
 263 G 2948 
 264 A 2607 
 265 T 2849 
 266 A 2891 
 267 C 3455 
 268 G 3152 
 269 C 3496 
 270 T 2911 
 271 A 2664 
 272 G 3411 
 273 G 2861 
 274 G 3040 
 275 G 3259 
 276 T 3260 
 277 T 2871 
 278 C 2709 
 279 G 4195 
 280 C 4775 
 281 G 3582 
 282 T 3524 
 283 A 3117 
 284 T 3519 
 285 C 3913 
 286 A 3302 
 287 C 4082 
 288 C 4759 
 289 G 3807 
 290 C 4397 
 291 C 5049 
 292 G 4281 
 293 G 4354 
 294 T 1310 
 295 G 2348 
 296 A 6456 
 297 T 6104 
 298 A 5133 
 299 C 5451 
 300 G 4704 
 301 C 4910 
 302 G 4065 
 303 A 3551 
 304 A 3747 
 305 A 3824 
 306 T 3546 
 307 C 3965 
 308 C 4400 
 309 T 4114 
 310 A 4157 
 311 T 4367 
 312 C 4894 
 313 A 3978 
 314 C 4702 
 315 C 5287 
 316 G 4723 
 317 C 5876 
 318 A 4443 
 319 A 4973 
 320 G 4215 
 321 G 3820 
 322 G 4315 
 323 A 3778 
 324 T 4131 
 325 A 3790 
 326 C 4449 
 327 C 4959 
 328 G 3582 
 329 G 3957 
 330 T 3993 
 331 A 3400 
 332 T 3654 
 333 C 3640 
 334 C 3731 
 335 C 4148 
 336 T 4013 
 337 T 3574 
 338 G 4179 
 339 C 4680 
 340 G 3533 
 341 G 3687 
 342 T 3404 
 343 G 3620 
 344 A 3048 
 345 T 3465 
 346 A 3482 
 347 G 3309 
 348 G 2898 
 349 G 2896 
 350 G 3039 
 351 T 3171 
 352 A 2690 
 353 T 2772 
 354 C 2863 
 355 C 2795 
 356 C 3170 
 357 T 3338 
 358 T 2998 
 359 G 3356 
 360 C 3573 
 361 G 2964 
 362 G 2848 
 363 T 2630 
 364 G 2834 
 365 A 2470 
 366 T 2608 
 367 A 3179 
 368 G 2598 
 369 G 2467 
 370 G 2361 
 371 G 2413 
 372 T 2210 
 373 A 2188 
 374 T 2027 
 375 C 2418 
 376 A 1950 
 377 C 1939 
 378 C 2464 
 379 G 1924 
 380 C 2286 
 381 G 1890 
 382 G 2391 

MAX = 54985   MIN = 815 

Length from 5'-end
 142 A        ########
 143 G        #
 144 T        #
 145 G        
 146 A        #########
 147 A        ##############################
 148 T        ########
 149 T        ##
 150 G        ####
 151 T        ##################
 152 A        ###################
 153 A        ##############################
 154 T        #########################################
 155 A        ##########################################
 156 C        ###############################################
 157 G        ############################################
 158 A        ###################################################
 159 C        ##########################################
 160 T        ######################################
 161 C        ############################
 162 A        ######################
 163 C        #######################
 164 T        ###############
 165 A        ##################
 166 T        ################
 167 A        #############
 168 G        ###########
 169 G        ########
 170 G        ########
 171 C        #######
 172 G        ########
 173 A        #####
 174 A        ###
 175 T        ###
 176 T        #####
 177 G        ######
 178 G        #####
 179 G        #######
 180 C        ######
 181 C        ######
 182 C        #######
 183 G        ########
 184 A        ##########
 185 C        ##########
 186 G        #################
 187 T        #####################
 188 C        #######################
 189 G        #####################################
 190 C        ####################################
 191 A        ##########################################
 192 T        ################################################
 193 G        #############################################################################
 194 C        ##############################################################################
 195 T        ########################################################################
 196 C        #################################################################################
 197 C        ############################################################################
 198 T        ##################################################################################################
 199 C        ##################################################################################################
 200 T        #################################################################################################
 201 A        ###################################################################################
 202 G        ############################################################################
 203 A        #########################################################
 204 C        #########################################################
 205 T        #####################################
 206 C        ##################################
 207 G        #############################
 208 A        #################
 209 G        ###################
 210 G        ################
 211 A        ##############
 212 A        ############
 213 T        ########
 214 T        #######
 215 C        ####
 216 G        #####
 217 G        ####
 218 T        ###
 219 A        ###
 220 C        ##
 221 C        ##
 222 C        #
 223 C        #
 224 C        #
 225 G        ##
 226 T        #
 227 A        #
 228 T        #
 229 C        #
 230 A        #
 231 C        #
 232 C        #
 233 G        ##
 234 G        ##
 235 C        ##
 236 G        ##
 237 G        ##
 238 T        ##
 239 G        ##
 240 A        ##
 241 T        ##
 242 A        ##
 243 C        ##
 244 G        ##
 245 A        #
 246 A        #
 247 T        #
 248 T        #
 249 C        ##
 250 G        ##
 251 T        ##
 252 A        ##
 253 T        ##
 254 C        ##
 255 C        ##
 256 C        ###
 257 T        ###
 258 T        ###
 259 C        ####
 260 G        ###
 261 G        ###
 262 T        ###
 263 G        ###
 264 A        ###
 265 T        ###
 266 A        ###
 267 C        ####
 268 G        ####
 269 C        ####
 270 T        ###
 271 A        ###
 272 G        ####
 273 G        ###
 274 G        ####
 275 G        ####
 276 T        ####
 277 T        ###
 278 C        ###
 279 G        ######
 280 C        #######
 281 G        #####
 282 T        ####
 283 A        ####
 284 T        ####
 285 C        #####
 286 A        ####
 287 C        #####
 288 C        #######
 289 G        #####
 290 C        ######
 291 C        #######
 292 G        ######
 293 G        ######
 294 T        
 295 G        ##
 296 A        ##########
 297 T        #########
 298 A        #######
 299 C        ########
 300 G        #######
 301 C        #######
 302 G        #####
 303 A        ####
 304 A        #####
 305 A        #####
 306 T        ####
 307 C        #####
 308 C        ######
 309 T        #####
 310 A        ######
 311 T        ######
 312 C        #######
 313 A        #####
 314 C        #######
 315 C        ########
 316 G        #######
 317 C        #########
 318 A        ######
 319 A        #######
 320 G        ######
 321 G        #####
 322 G        ######
 323 A        #####
 324 T        ######
 325 A        #####
 326 C        ######
 327 C        #######
 328 G        #####
 329 G        #####
 330 T        #####
 331 A        ####
 332 T        #####
 333 C        #####
 334 C        #####
 335 C        ######
 336 T        #####
 337 T        #####
 338 G        ######
 339 C        #######
 340 G        ####
 341 G        #####
 342 T        ####
 343 G        #####
 344 A        ####
 345 T        ####
 346 A        ####
 347 G        ####
 348 G        ###
 349 G        ###
 350 G        ####
 351 T        ####
 352 A        ###
 353 T        ###
 354 C        ###
 355 C        ###
 356 C        ####
 357 T        ####
 358 T        ###
 359 G        ####
 360 C        #####
 361 G        ###
 362 G        ###
 363 T        ###
 364 G        ###
 365 A        ###
 366 T        ###
 367 A        ####
 368 G        ###
 369 G        ###
 370 G        ##
 371 G        ##
 372 T        ##
 373 A        ##
 374 T        ##
 375 C        ##
 376 A        ##
 377 C        ##
 378 C        ##
 379 G        ##
 380 C        ##
 381 G        #
 382 G        ##


Length from 3'-end
 248 A        ########
 247 G        #
 246 T        #
 245 G        
 244 A        #########
 243 A        ##############################
 242 T        ########
 241 T        ##
 240 G        ####
 239 T        ##################
 238 A        ###################
 237 A        ##############################
 236 T        #########################################
 235 A        ##########################################
 234 C        ###############################################
 233 G        ############################################
 232 A        ###################################################
 231 C        ##########################################
 230 T        ######################################
 229 C        ############################
 228 A        ######################
 227 C        #######################
 226 T        ###############
 225 A        ##################
 224 T        ################
 223 A        #############
 222 G        ###########
 221 G        ########
 220 G        ########
 219 C        #######
 218 G        ########
 217 A        #####
 216 A        ###
 215 T        ###
 214 T        #####
 213 G        ######
 212 G        #####
 211 G        #######
 210 C        ######
 209 C        ######
 208 C        #######
 207 G        ########
 206 A        ##########
 205 C        ##########
 204 G        #################
 203 T        #####################
 202 C        #######################
 201 G        #####################################
 200 C        ####################################
 199 A        ##########################################
 198 T        ################################################
 197 G        #############################################################################
 196 C        ##############################################################################
 195 T        ########################################################################
 194 C        #################################################################################
 193 C        ############################################################################
 192 T        ##################################################################################################
 191 C        ##################################################################################################
 190 T        #################################################################################################
 189 A        ###################################################################################
 188 G        ############################################################################
 187 A        #########################################################
 186 C        #########################################################
 185 T        #####################################
 184 C        ##################################
 183 G        #############################
 182 A        #################
 181 G        ###################
 180 G        ################
 179 A        ##############
 178 A        ############
 177 T        ########
 176 T        #######
 175 C        ####
 174 G        #####
 173 G        ####
 172 T        ###
 171 A        ###
 170 C        ##
 169 C        ##
 168 C        #
 167 C        #
 166 C        #
 165 G        ##
 164 T        #
 163 A        #
 162 T        #
 161 C        #
 160 A        #
 159 C        #
 158 C        #
 157 G        ##
 156 G        ##
 155 C        ##
 154 G        ##
 153 G        ##
 152 T        ##
 151 G        ##
 150 A        ##
 149 T        ##
 148 A        ##
 147 C        ##
 146 G        ##
 145 A        #
 144 A        #
 143 T        #
 142 T        #
 141 C        ##
 140 G        ##
 139 T        ##
 138 A        ##
 137 T        ##
 136 C        ##
 135 C        ##
 134 C        ###
 133 T        ###
 132 T        ###
 131 C        ####
 130 G        ###
 129 G        ###
 128 T        ###
 127 G        ###
 126 A        ###
 125 T        ###
 124 A        ###
 123 C        ####
 122 G        ####
 121 C        ####
 120 T        ###
 119 A        ###
 118 G        ####
 117 G        ###
 116 G        ####
 115 G        ####
 114 T        ####
 113 T        ###
 112 C        ###
 111 G        ######
 110 C        #######
 109 G        #####
 108 T        ####
 107 A        ####
 106 T        ####
 105 C        #####
 104 A        ####
 103 C        #####
 102 C        #######
 101 G        #####
 100 C        ######
 99 C         #######
 98 G         ######
 97 G         ######
 96 T         
 95 G         ##
 94 A         ##########
 93 T         #########
 92 A         #######
 91 C         ########
 90 G         #######
 89 C         #######
 88 G         #####
 87 A         ####
 86 A         #####
 85 A         #####
 84 T         ####
 83 C         #####
 82 C         ######
 81 T         #####
 80 A         ######
 79 T         ######
 78 C         #######
 77 A         #####
 76 C         #######
 75 C         ########
 74 G         #######
 73 C         #########
 72 A         ######
 71 A         #######
 70 G         ######
 69 G         #####
 68 G         ######
 67 A         #####
 66 T         ######
 65 A         #####
 64 C         ######
 63 C         #######
 62 G         #####
 61 G         #####
 60 T         #####
 59 A         ####
 58 T         #####
 57 C         #####
 56 C         #####
 55 C         ######
 54 T         #####
 53 T         #####
 52 G         ######
 51 C         #######
 50 G         ####
 49 G         #####
 48 T         ####
 47 G         #####
 46 A         ####
 45 T         ####
 44 A         ####
 43 G         ####
 42 G         ###
 41 G         ###
 40 G         ####
 39 T         ####
 38 A         ###
 37 T         ###
 36 C         ###
 35 C         ###
 34 C         ####
 33 T         ####
 32 T         ###
 31 G         ####
 30 C         #####
 29 G         ###
 28 G         ###
 27 T         ###
 26 G         ###
 25 A         ###
 24 T         ###
 23 A         ####
 22 G         ###
 21 G         ###
 20 G         ##
 19 G         ##
 18 T         ##
 17 A         ##
 16 T         ##
 15 C         ##
 14 A         ##
 13 C         ##
 12 C         ##
 11 G         ##
 10 C         ##
 9 G          #
 8 G          ##


Length from nick
-56 A         ########
-55 G         #
-54 T         #
-53 G         
-52 A         #########
-51 A         ##############################
-50 T         ########
-49 T         ##
-48 G         ####
-47 T         ##################
-46 A         ###################
-45 A         ##############################
-44 T         #########################################
-43 A         ##########################################
-42 C         ###############################################
-41 G         ############################################
-40 A         ###################################################
-39 C         ##########################################
-38 T         ######################################
-37 C         ############################
-36 A         ######################
-35 C         #######################
-34 T         ###############
-33 A         ##################
-32 T         ################
-31 A         #############
-30 G         ###########
-29 G         ########
-28 G         ########
-27 C         #######
-26 G         ########
-25 A         #####
-24 A         ###
-23 T         ###
-22 T         #####
-21 G         ######
-20 G         #####
-19 G         #######
-18 C         ######
-17 C         ######
-16 C         #######
-15 G         ########
-14 A         ##########
-13 C         ##########
-12 G         #################
-11 T         #####################
-10 C         #######################
-9 G          #####################################
-8 C          ####################################
-7 A          ##########################################
-6 T          ################################################
-5 G          #############################################################################
-4 C          ##############################################################################
-3 T          ########################################################################
-2 C          #################################################################################
-1 C          ############################################################################
 1 T          ##################################################################################################
 2 C          ##################################################################################################
 3 T          #################################################################################################
 4 A          ###################################################################################
 5 G          ############################################################################
 6 A          #########################################################
 7 C          #########################################################
 8 T          #####################################
 9 C          ##################################
 10 G         #############################
 11 A         #################
 12 G         ###################
 13 G         ################
 14 A         ##############
 15 A         ############
 16 T         ########
 17 T         #######
 18 C         ####
 19 G         #####
 20 G         ####
 21 T         ###
 22 A         ###
 23 C         ##
 24 C         ##
 25 C         #
 26 C         #
 27 C         #
 28 G         ##
 29 T         #
 30 A         #
 31 T         #
 32 C         #
 33 A         #
 34 C         #
 35 C         #
 36 G         ##
 37 G         ##
 38 C         ##
 39 G         ##
 40 G         ##
 41 T         ##
 42 G         ##
 43 A         ##
 44 T         ##
 45 A         ##
 46 C         ##
 47 G         ##
 48 A         #
 49 A         #
 50 T         #
 51 T         #
 52 C         ##
 53 G         ##
 54 T         ##
 55 A         ##
 56 T         ##
 57 C         ##
 58 C         ##
 59 C         ###
 60 T         ###
 61 T         ###
 62 C         ####
 63 G         ###
 64 G         ###
 65 T         ###
 66 G         ###
 67 A         ###
 68 T         ###
 69 A         ###
 70 C         ####
 71 G         ####
 72 C         ####
 73 T         ###
 74 A         ###
 75 G         ####
 76 G         ###
 77 G         ####
 78 G         ####
 79 T         ####
 80 T         ###
 81 C         ###
 82 G         ######
 83 C         #######
 84 G         #####
 85 T         ####
 86 A         ####
 87 T         ####
 88 C         #####
 89 A         ####
 90 C         #####
 91 C         #######
 92 G         #####
 93 C         ######
 94 C         #######
 95 G         ######
 96 G         ######
 97 T         
 98 G         ##
 99 A         ##########
 100 T        #########
 101 A        #######
 102 C        ########
 103 G        #######
 104 C        #######
 105 G        #####
 106 A        ####
 107 A        #####
 108 A        #####
 109 T        ####
 110 C        #####
 111 C        ######
 112 T        #####
 113 A        ######
 114 T        ######
 115 C        #######
 116 A        #####
 117 C        #######
 118 C        ########
 119 G        #######
 120 C        #########
 121 A        ######
 122 A        #######
 123 G        ######
 124 G        #####
 125 G        ######
 126 A        #####
 127 T        ######
 128 A        #####
 129 C        ######
 130 C        #######
 131 G        #####
 132 G        #####
 133 T        #####
 134 A        ####
 135 T        #####
 136 C        #####
 137 C        #####
 138 C        ######
 139 T        #####
 140 T        #####
 141 G        ######
 142 C        #######
 143 G        ####
 144 G        #####
 145 T        ####
 146 G        #####
 147 A        ####
 148 T        ####
 149 A        ####
 150 G        ####
 151 G        ###
 152 G        ###
 153 G        ####
 154 T        ####
 155 A        ###
 156 T        ###
 157 C        ###
 158 C        ###
 159 C        ####
 160 T        ####
 161 T        ###
 162 G        ####
 163 C        #####
 164 G        ###
 165 G        ###
 166 T        ###
 167 G        ###
 168 A        ###
 169 T        ###
 170 A        ####
 171 G        ###
 172 G        ###
 173 G        ##
 174 G        ##
 175 T        ##
 176 A        ##
 177 T        ##
 178 C        ##
 179 A        ##
 180 C        ##
 181 C        ##
 182 G        ##
 183 C        ##
 184 G        #
 185 G        ##


Name of gel and number of scan = No65 def.193 - 4 min
Name of sequence = Clon No 1670
Number of lanes =  11 
Lane for analysis =  10 
Number of analysing nucleotide =  241 
First analysing nucleotide =  142 
3'-nucleotide before nik =  197 
5'-AGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTGTAATACGACTCACTATAGGGCGAATTGGGCCCGACGTCGCATGCTCCTCTAGACTCGAGGAATTCGGTACCCCCGTATCACCGGCGGTGATACGAATTCGTATCCCTTCGGTGATACGCTAGGGGTTCGCGTATCACCGCCGGTGATACGCGAAATCCTATCACCGCAAGGGATACCGGTATCCCTTGCGGTGATAGGGGTATCCCTTGCGGTGATAGGGGTATCACCGCGGTGATAGG0
Length of fragment =  389   P(K)=P(K)/100

 142 A 14287 
 143 G 1741 
 144 T 7748 
 145 G 5257 
 146 A 7574 
 147 A 5719 
 148 T 6594 
 149 T 10624 
 150 G 13986 
 151 T 14582 
 152 A 29291 
 153 A 40584 
 154 T 59524 
 155 A 51651 
 156 C 74124 
 157 G 80203 
 158 A 66483 
 159 C 61903 
 160 T 54091 
 161 C 60643 
 162 A 57801 
 163 C 41131 
 164 T 35550 
 165 A 46870 
 166 T 44925 
 167 A 27205 
 168 G 27147 
 169 G 30359 
 170 G 19493 
 171 C 15677 
 172 G 16968 
 173 A 11771 
 174 A 12330 
 175 T 6836 
 176 T 18950 
 177 G 334 
 178 G 16377 
 179 G 13332 
 180 C 11154 
 181 C 10677 
 182 C 12407 
 183 G 15294 
 184 A 20444 
 185 C 18681 
 186 G 24011 
 187 T 25217 
 188 C 27248 
 189 G 56528 
 190 C 49063 
 191 A 60939 
 192 T 56807 
 193 G 142184 
 194 C 95808 
 195 T 96686 
 196 C 139126 
 197 C 115871 
 198 T 149243 
 199 C 158505 
 200 T 159043 
 201 A 131913 
 202 G 129464 
 203 A 90403 
 204 C 100616 
 205 T 64487 
 206 C 63033 
 207 G 52435 
 208 A 48143 
 209 G 66914 
 210 G 43828 
 211 A 30113 
 212 A 32485 
 213 T 18948 
 214 T 17699 
 215 C 17133 
 216 G 13976 
 217 G 5963 
 218 T 5989 
 219 A 7836 
 220 C 5799 
 221 C 5485 
 222 C 6035 
 223 C 5607 
 224 C 5249 
 225 G 6649 
 226 T 4959 
 227 A 5587 
 228 T 4777 
 229 C 4363 
 230 A 5428 
 231 C 4920 
 232 C 5118 
 233 G 5653 
 234 G 6208 
 235 C 6207 
 236 G 6883 
 237 G 6372 
 238 T 5648 
 239 G 9046 
 240 A 3682 
 241 T 5205 
 242 A 6936 
 243 C 5687 
 244 G 6213 
 245 A 5279 
 246 A 5752 
 247 T 4956 
 248 T 5302 
 249 C 6125 
 250 G 7380 
 251 T 6402 
 252 A 7319 
 253 T 6399 
 254 C 6733 
 255 C 7158 
 256 C 8593 
 257 T 8007 
 258 T 7836 
 259 C 10578 
 260 G 8543 
 261 G 9479 
 262 T 8058 
 263 G 9853 
 264 A 7675 
 265 T 8954 
 266 A 8795 
 267 C 11905 
 268 G 8889 
 269 C 11329 
 270 T 9288 
 271 A 7618 
 272 G 8729 
 273 G 9203 
 274 G 8202 
 275 G 10697 
 276 T 7062 
 277 T 9469 
 278 C 7380 
 279 G 16504 
 280 C 17184 
 281 G 9722 
 282 T 10806 
 283 A 8533 
 284 T 8655 
 285 C 11836 
 286 A 6042 
 287 C 7455 
 288 C 9995 
 289 G 6663 
 290 C 10547 
 291 C 11736 
 292 G 6681 
 293 G 6245 
 294 T 53242 
 295 G 26682 
 296 A 8844 
 297 T 15923 
 298 A 13394 
 299 C 15240 
 300 G 13918 
 301 C 14721 
 302 G 15587 
 303 A 7046 
 304 A 10626 
 305 A 11337 
 306 T 10793 
 307 C 12293 
 308 C 13640 
 309 T 12611 
 310 A 12726 
 311 T 12834 
 312 C 16488 
 313 A 12207 
 314 C 15185 
 315 C 20502 
 316 G 11893 
 317 C 25941 
 318 A 11895 
 319 A 9541 
 320 G 13041 
 321 G 11351 
 322 G 14441 
 323 A 11291 
 324 T 13044 
 325 A 11389 
 326 C 13745 
 327 C 16842 
 328 G 10365 
 329 G 12110 
 330 T 12655 
 331 A 10171 
 332 T 10792 
 333 C 11736 
 334 C 11658 
 335 C 13625 
 336 T 12278 
 337 T 10887 
 338 G 14270 
 339 C 15757 
 340 G 11044 
 341 G 12211 
 342 T 10475 
 343 G 12170 
 344 A 9450 
 345 T 11738 
 346 A 8628 
 347 G 10014 
 348 G 9391 
 349 G 9103 
 350 G 9862 
 351 T 10199 
 352 A 8185 
 353 T 8896 
 354 C 8970 
 355 C 8909 
 356 C 10474 
 357 T 10523 
 358 T 9086 
 359 G 11345 
 360 C 12488 
 361 G 9250 
 362 G 9112 
 363 T 8187 
 364 G 9703 
 365 A 7034 
 366 T 8904 
 367 A 7164 
 368 G 8278 
 369 G 7475 
 370 G 7265 
 371 G 7786 
 372 T 6299 
 373 A 6775 
 374 T 5832 
 375 C 8270 
 376 A 5667 
 377 C 5799 
 378 C 8355 
 379 G 5627 
 380 C 7753 
 381 G 5299 
 382 G 10966 

MAX = 159043  MIN = 334 

Length from 5'-end
 142 A        ########
 143 G        
 144 T        ####
 145 G        ###
 146 A        ####
 147 A        ###
 148 T        ###
 149 T        ######
 150 G        ########
 151 T        ########
 152 A        ##################
 153 A        #########################
 154 T        #####################################
 155 A        ################################
 156 C        ##############################################
 157 G        ##################################################
 158 A        #########################################
 159 C        ######################################
 160 T        #################################
 161 C        #####################################
 162 A        ####################################
 163 C        #########################
 164 T        ######################
 165 A        #############################
 166 T        ############################
 167 A        ################
 168 G        ################
 169 G        ##################
 170 G        ############
 171 C        #########
 172 G        ##########
 173 A        #######
 174 A        #######
 175 T        ####
 176 T        ###########
 177 G        
 178 G        ##########
 179 G        ########
 180 C        ######
 181 C        ######
 182 C        #######
 183 G        #########
 184 A        ############
 185 C        ###########
 186 G        ##############
 187 T        ###############
 188 C        ################
 189 G        ###################################
 190 C        ##############################
 191 A        ######################################
 192 T        ###################################
 193 G        #########################################################################################
 194 C        ############################################################
 195 T        ############################################################
 196 C        #######################################################################################
 197 C        ########################################################################
 198 T        #############################################################################################
 199 C        ###################################################################################################
 200 T        ###################################################################################################
 201 A        ##################################################################################
 202 G        #################################################################################
 203 A        ########################################################
 204 C        ###############################################################
 205 T        ########################################
 206 C        #######################################
 207 G        ################################
 208 A        ##############################
 209 G        #########################################
 210 G        ###########################
 211 A        ##################
 212 A        ####################
 213 T        ###########
 214 T        ##########
 215 C        ##########
 216 G        ########
 217 G        ###
 218 T        ###
 219 A        ####
 220 C        ###
 221 C        ###
 222 C        ###
 223 C        ###
 224 C        ###
 225 G        ###
 226 T        ##
 227 A        ###
 228 T        ##
 229 C        ##
 230 A        ###
 231 C        ##
 232 C        ###
 233 G        ###
 234 G        ###
 235 C        ###
 236 G        ####
 237 G        ###
 238 T        ###
 239 G        #####
 240 A        ##
 241 T        ###
 242 A        ####
 243 C        ###
 244 G        ###
 245 A        ###
 246 A        ###
 247 T        ##
 248 T        ###
 249 C        ###
 250 G        ####
 251 T        ###
 252 A        ####
 253 T        ###
 254 C        ####
 255 C        ####
 256 C        #####
 257 T        ####
 258 T        ####
 259 C        ######
 260 G        #####
 261 G        #####
 262 T        ####
 263 G        #####
 264 A        ####
 265 T        #####
 266 A        #####
 267 C        #######
 268 G        #####
 269 C        ######
 270 T        #####
 271 A        ####
 272 G        #####
 273 G        #####
 274 G        ####
 275 G        ######
 276 T        ####
 277 T        #####
 278 C        ####
 279 G        ##########
 280 C        ##########
 281 G        #####
 282 T        ######
 283 A        #####
 284 T        #####
 285 C        #######
 286 A        ###
 287 C        ####
 288 C        ######
 289 G        ###
 290 C        ######
 291 C        #######
 292 G        ###
 293 G        ###
 294 T        #################################
 295 G        ################
 296 A        #####
 297 T        #########
 298 A        ########
 299 C        #########
 300 G        ########
 301 C        #########
 302 G        #########
 303 A        ####
 304 A        ######
 305 A        ######
 306 T        ######
 307 C        #######
 308 C        ########
 309 T        #######
 310 A        #######
 311 T        #######
 312 C        ##########
 313 A        #######
 314 C        #########
 315 C        ############
 316 G        #######
 317 C        ################
 318 A        #######
 319 A        #####
 320 G        #######
 321 G        ######
 322 G        ########
 323 A        ######
 324 T        #######
 325 A        ######
 326 C        ########
 327 C        ##########
 328 G        ######
 329 G        #######
 330 T        #######
 331 A        ######
 332 T        ######
 333 C        #######
 334 C        #######
 335 C        ########
 336 T        #######
 337 T        ######
 338 G        ########
 339 C        #########
 340 G        ######
 341 G        #######
 342 T        ######
 343 G        #######
 344 A        #####
 345 T        #######
 346 A        #####
 347 G        ######
 348 G        #####
 349 G        #####
 350 G        #####
 351 T        ######
 352 A        ####
 353 T        #####
 354 C        #####
 355 C        #####
 356 C        ######
 357 T        ######
 358 T        #####
 359 G        ######
 360 C        #######
 361 G        #####
 362 G        #####
 363 T        ####
 364 G        #####
 365 A        ####
 366 T        #####
 367 A        ####
 368 G        ####
 369 G        ####
 370 G        ####
 371 G        ####
 372 T        ###
 373 A        ####
 374 T        ###
 375 C        ####
 376 A        ###
 377 C        ###
 378 C        #####
 379 G        ###
 380 C        ####
 381 G        ###
 382 G        ######


Length from 3'-end
 248 A        ########
 247 G        
 246 T        ####
 245 G        ###
 244 A        ####
 243 A        ###
 242 T        ###
 241 T        ######
 240 G        ########
 239 T        ########
 238 A        ##################
 237 A        #########################
 236 T        #####################################
 235 A        ################################
 234 C        ##############################################
 233 G        ##################################################
 232 A        #########################################
 231 C        ######################################
 230 T        #################################
 229 C        #####################################
 228 A        ####################################
 227 C        #########################
 226 T        ######################
 225 A        #############################
 224 T        ############################
 223 A        ################
 222 G        ################
 221 G        ##################
 220 G        ############
 219 C        #########
 218 G        ##########
 217 A        #######
 216 A        #######
 215 T        ####
 214 T        ###########
 213 G        
 212 G        ##########
 211 G        ########
 210 C        ######
 209 C        ######
 208 C        #######
 207 G        #########
 206 A        ############
 205 C        ###########
 204 G        ##############
 203 T        ###############
 202 C        ################
 201 G        ###################################
 200 C        ##############################
 199 A        ######################################
 198 T        ###################################
 197 G        #########################################################################################
 196 C        ############################################################
 195 T        ############################################################
 194 C        #######################################################################################
 193 C        ########################################################################
 192 T        #############################################################################################
 191 C        ###################################################################################################
 190 T        ###################################################################################################
 189 A        ##################################################################################
 188 G        #################################################################################
 187 A        ########################################################
 186 C        ###############################################################
 185 T        ########################################
 184 C        #######################################
 183 G        ################################
 182 A        ##############################
 181 G        #########################################
 180 G        ###########################
 179 A        ##################
 178 A        ####################
 177 T        ###########
 176 T        ##########
 175 C        ##########
 174 G        ########
 173 G        ###
 172 T        ###
 171 A        ####
 170 C        ###
 169 C        ###
 168 C        ###
 167 C        ###
 166 C        ###
 165 G        ###
 164 T        ##
 163 A        ###
 162 T        ##
 161 C        ##
 160 A        ###
 159 C        ##
 158 C        ###
 157 G        ###
 156 G        ###
 155 C        ###
 154 G        ####
 153 G        ###
 152 T        ###
 151 G        #####
 150 A        ##
 149 T        ###
 148 A        ####
 147 C        ###
 146 G        ###
 145 A        ###
 144 A        ###
 143 T        ##
 142 T        ###
 141 C        ###
 140 G        ####
 139 T        ###
 138 A        ####
 137 T        ###
 136 C        ####
 135 C        ####
 134 C        #####
 133 T        ####
 132 T        ####
 131 C        ######
 130 G        #####
 129 G        #####
 128 T        ####
 127 G        #####
 126 A        ####
 125 T        #####
 124 A        #####
 123 C        #######
 122 G        #####
 121 C        ######
 120 T        #####
 119 A        ####
 118 G        #####
 117 G        #####
 116 G        ####
 115 G        ######
 114 T        ####
 113 T        #####
 112 C        ####
 111 G        ##########
 110 C        ##########
 109 G        #####
 108 T        ######
 107 A        #####
 106 T        #####
 105 C        #######
 104 A        ###
 103 C        ####
 102 C        ######
 101 G        ###
 100 C        ######
 99 C         #######
 98 G         ###
 97 G         ###
 96 T         #################################
 95 G         ################
 94 A         #####
 93 T         #########
 92 A         ########
 91 C         #########
 90 G         ########
 89 C         #########
 88 G         #########
 87 A         ####
 86 A         ######
 85 A         ######
 84 T         ######
 83 C         #######
 82 C         ########
 81 T         #######
 80 A         #######
 79 T         #######
 78 C         ##########
 77 A         #######
 76 C         #########
 75 C         ############
 74 G         #######
 73 C         ################
 72 A         #######
 71 A         #####
 70 G         #######
 69 G         ######
 68 G         ########
 67 A         ######
 66 T         #######
 65 A         ######
 64 C         ########
 63 C         ##########
 62 G         ######
 61 G         #######
 60 T         #######
 59 A         ######
 58 T         ######
 57 C         #######
 56 C         #######
 55 C         ########
 54 T         #######
 53 T         ######
 52 G         ########
 51 C         #########
 50 G         ######
 49 G         #######
 48 T         ######
 47 G         #######
 46 A         #####
 45 T         #######
 44 A         #####
 43 G         ######
 42 G         #####
 41 G         #####
 40 G         #####
 39 T         ######
 38 A         ####
 37 T         #####
 36 C         #####
 35 C         #####
 34 C         ######
 33 T         ######
 32 T         #####
 31 G         ######
 30 C         #######
 29 G         #####
 28 G         #####
 27 T         ####
 26 G         #####
 25 A         ####
 24 T         #####
 23 A         ####
 22 G         ####
 21 G         ####
 20 G         ####
 19 G         ####
 18 T         ###
 17 A         ####
 16 T         ###
 15 C         ####
 14 A         ###
 13 C         ###
 12 C         #####
 11 G         ###
 10 C         ####
 9 G          ###
 8 G          ######


Length from nick
-56 A         ########
-55 G         
-54 T         ####
-53 G         ###
-52 A         ####
-51 A         ###
-50 T         ###
-49 T         ######
-48 G         ########
-47 T         ########
-46 A         ##################
-45 A         #########################
-44 T         #####################################
-43 A         ################################
-42 C         ##############################################
-41 G         ##################################################
-40 A         #########################################
-39 C         ######################################
-38 T         #################################
-37 C         #####################################
-36 A         ####################################
-35 C         #########################
-34 T         ######################
-33 A         #############################
-32 T         ############################
-31 A         ################
-30 G         ################
-29 G         ##################
-28 G         ############
-27 C         #########
-26 G         ##########
-25 A         #######
-24 A         #######
-23 T         ####
-22 T         ###########
-21 G         
-20 G         ##########
-19 G         ########
-18 C         ######
-17 C         ######
-16 C         #######
-15 G         #########
-14 A         ############
-13 C         ###########
-12 G         ##############
-11 T         ###############
-10 C         ################
-9 G          ###################################
-8 C          ##############################
-7 A          ######################################
-6 T          ###################################
-5 G          #########################################################################################
-4 C          ############################################################
-3 T          ############################################################
-2 C          #######################################################################################
-1 C          ########################################################################
 1 T          #############################################################################################
 2 C          ###################################################################################################
 3 T          ###################################################################################################
 4 A          ##################################################################################
 5 G          #################################################################################
 6 A          ########################################################
 7 C          ###############################################################
 8 T          ########################################
 9 C          #######################################
 10 G         ################################
 11 A         ##############################
 12 G         #########################################
 13 G         ###########################
 14 A         ##################
 15 A         ####################
 16 T         ###########
 17 T         ##########
 18 C         ##########
 19 G         ########
 20 G         ###
 21 T         ###
 22 A         ####
 23 C         ###
 24 C         ###
 25 C         ###
 26 C         ###
 27 C         ###
 28 G         ###
 29 T         ##
 30 A         ###
 31 T         ##
 32 C         ##
 33 A         ###
 34 C         ##
 35 C         ###
 36 G         ###
 37 G         ###
 38 C         ###
 39 G         ####
 40 G         ###
 41 T         ###
 42 G         #####
 43 A         ##
 44 T         ###
 45 A         ####
 46 C         ###
 47 G         ###
 48 A         ###
 49 A         ###
 50 T         ##
 51 T         ###
 52 C         ###
 53 G         ####
 54 T         ###
 55 A         ####
 56 T         ###
 57 C         ####
 58 C         ####
 59 C         #####
 60 T         ####
 61 T         ####
 62 C         ######
 63 G         #####
 64 G         #####
 65 T         ####
 66 G         #####
 67 A         ####
 68 T         #####
 69 A         #####
 70 C         #######
 71 G         #####
 72 C         ######
 73 T         #####
 74 A         ####
 75 G         #####
 76 G         #####
 77 G         ####
 78 G         ######
 79 T         ####
 80 T         #####
 81 C         ####
 82 G         ##########
 83 C         ##########
 84 G         #####
 85 T         ######
 86 A         #####
 87 T         #####
 88 C         #######
 89 A         ###
 90 C         ####
 91 C         ######
 92 G         ###
 93 C         ######
 94 C         #######
 95 G         ###
 96 G         ###
 97 T         #################################
 98 G         ################
 99 A         #####
 100 T        #########
 101 A        ########
 102 C        #########
 103 G        ########
 104 C        #########
 105 G        #########
 106 A        ####
 107 A        ######
 108 A        ######
 109 T        ######
 110 C        #######
 111 C        ########
 112 T        #######
 113 A        #######
 114 T        #######
 115 C        ##########
 116 A        #######
 117 C        #########
 118 C        ############
 119 G        #######
 120 C        ################
 121 A        #######
 122 A        #####
 123 G        #######
 124 G        ######
 125 G        ########
 126 A        ######
 127 T        #######
 128 A        ######
 129 C        ########
 130 C        ##########
 131 G        ######
 132 G        #######
 133 T        #######
 134 A        ######
 135 T        ######
 136 C        #######
 137 C        #######
 138 C        ########
 139 T        #######
 140 T        ######
 141 G        ########
 142 C        #########
 143 G        ######
 144 G        #######
 145 T        ######
 146 G        #######
 147 A        #####
 148 T        #######
 149 A        #####
 150 G        ######
 151 G        #####
 152 G        #####
 153 G        #####
 154 T        ######
 155 A        ####
 156 T        #####
 157 C        #####
 158 C        #####
 159 C        ######
 160 T        ######
 161 T        #####
 162 G        ######
 163 C        #######
 164 G        #####
 165 G        #####
 166 T        ####
 167 G        #####
 168 A        ####
 169 T        #####
 170 A        ####
 171 G        ####
 172 G        ####
 173 G        ####
 174 G        ####
 175 T        ###
 176 A        ####
 177 T        ###
 178 C        ####
 179 A        ###
 180 C        ###
 181 C        #####
 182 G        ###
 183 C        ####
 184 G        ###
 185 G        ######


Name of gel and number of scan = No67-1681 def.179
Name of sequence = Clon No 1681
Number of lanes =  4 
Lane for analysis =  3 
Number of analysing nucleotide =  208 
First analysing nucleotide =  37 
3'-nucleotide before nik =  156 
5'-ATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTGTAATACGACTCACTATAGGGCGAATTGGGCCCGACGTCGCATGCTCCTCTAGACTCGAGGAATTCGGTACTTTTAAAAGACTCGCGATAAGCTTGGATC0
Length of fragment =  253   P(K)=P(K)/100

 37 G 5919 
 38 C 1871 
 39 G 2233 
 40 G 1611 
 41 G 1291 
 42 C 1122 
 43 C 1019 
 44 T 847 
 45 C 909 
 46 T 745 
 47 T 655 
 48 C 659 
 49 G 587 
 50 C 741 
 51 T 705 
 52 A 662 
 53 T 662 
 54 T 556 
 55 A 700 
 56 C 575 
 57 G 596 
 58 C 666 
 59 C 663 
 60 A 727 
 61 G 626 
 62 C 634 
 63 T 723 
 64 G 770 
 65 G 867 
 66 C 685 
 67 G 607 
 68 A 676 
 69 A 681 
 70 A 753 
 71 G 690 
 72 G 623 
 73 G 692 
 74 G 765 
 75 G 637 
 76 A 717 
 77 T 801 
 78 G 705 
 79 T 675 
 80 G 766 
 81 C 733 
 82 T 808 
 83 G 869 
 84 C 898 
 85 A 914 
 86 A 908 
 87 G 917 
 88 G 824 
 89 C 793 
 90 G 802 
 91 A 773 
 92 T 823 
 93 T 776 
 94 A 896 
 95 A 935 
 96 G 865 
 97 T 810 
 98 T 826 
 99 G 923 
 100 G 989 
 101 G 965 
 102 T 1064 
 103 A 991 
 104 A 983 
 105 C 1652 
 106 G 1350 
 107 C 1155 
 108 C 1095 
 109 A 1143 
 110 G 981 
 111 G 1061 
 112 G 983 
 113 T 982 
 114 T 947 
 115 T 853 
 116 T 891 
 117 C 910 
 118 C 942 
 119 C 962 
 120 A 953 
 121 G 943 
 122 T 951 
 123 C 960 
 124 A 993 
 125 C 1090 
 126 G 994 
 127 A 969 
 128 C 989 
 129 G 1017 
 130 T 1009 
 131 T 985 
 132 G 1036 
 133 T 987 
 134 A 1022 
 135 A 1017 
 136 A 1086 
 137 A 1252 
 138 C 1383 
 139 G 1463 
 140 A 1538 
 141 C 1863 
 142 G 2150 
 143 G 2865 
 144 C 3107 
 145 C 3201 
 146 A 3880 
 147 G 5975 
 148 T 7344 
 149 G 10157 
 150 A 12723 
 151 A 22334 
 152 T 31493 
 153 T 35432 
 154 G 42707 
 155 T 48664 
 156 A 46562 
 157 A 42675 
 158 T 41690 
 159 A 36591 
 160 C 30123 
 161 G 19832 
 162 A 11835 
 163 C 10244 
 164 T 7426 
 165 C 5584 
 166 A 3768 
 167 C 3105 
 168 T 2454 
 169 A 1833 
 170 T 1709 
 171 A 1505 
 172 G 1525 
 173 G 1513 
 174 G 1427 
 175 C 1218 
 176 G 1299 
 177 A 1142 
 178 A 1110 
 179 T 1078 
 180 T 1094 
 181 G 1151 
 182 G 1066 
 183 G 1060 
 184 C 880 
 185 C 857 
 186 C 1042 
 187 G 1018 
 188 A 926 
 189 C 924 
 190 G 1021 
 191 T 1030 
 192 C 934 
 193 G 1165 
 194 C 1143 
 195 A 1292 
 196 T 1654 
 197 G 2672 
 198 C 3278 
 199 T 4102 
 200 C 5486 
 201 C 5362 
 202 T 6274 
 203 C 5307 
 204 T 3881 
 205 A 2831 
 206 G 2381 
 207 A 1903 
 208 C 1574 
 209 T 1416 
 210 C 1346 
 211 G 1268 
 212 A 1100 
 213 G 1112 
 214 G 1001 
 215 A 984 
 216 A 892 
 217 T 808 
 218 T 789 
 219 C 804 
 220 G 891 
 221 G 795 
 222 T 785 
 223 A 807 
 224 C 770 
 225 T 858 
 226 T 796 
 227 T 1001 
 228 T 805 
 229 A 828 
 230 A 698 
 231 A 628 
 232 A 600 
 233 G 615 
 234 A 484 
 235 C 416 
 236 T 424 
 237 C 359 
 238 G 359 
 239 C 249 
 240 G 451 
 241 A 245 
 242 T 234 
 243 A 206 
 244 A 181 

MAX = 48664   MIN = 181 

Length from 5'-end
 37 G         ###########
 38 C         ###
 39 G         ####
 40 G         ##
 41 G         ##
 42 C         #
 43 C         #
 44 T         #
 45 C         #
 46 T         #
 47 T         
 48 C         
 49 G         
 50 C         #
 51 T         #
 52 A         
 53 T         
 54 T         
 55 A         #
 56 C         
 57 G         
 58 C         
 59 C         
 60 A         #
 61 G         
 62 C         
 63 T         #
 64 G         #
 65 G         #
 66 C         #
 67 G         
 68 A         #
 69 A         #
 70 A         #
 71 G         #
 72 G         
 73 G         #
 74 G         #
 75 G         
 76 A         #
 77 T         #
 78 G         #
 79 T         #
 80 G         #
 81 C         #
 82 T         #
 83 G         #
 84 C         #
 85 A         #
 86 A         #
 87 G         #
 88 G         #
 89 C         #
 90 G         #
 91 A         #
 92 T         #
 93 T         #
 94 A         #
 95 A         #
 96 G         #
 97 T         #
 98 T         #
 99 G         #
 100 G        #
 101 G        #
 102 T        #
 103 A        #
 104 A        #
 105 C        ###
 106 G        ##
 107 C        ##
 108 C        #
 109 A        #
 110 G        #
 111 G        #
 112 G        #
 113 T        #
 114 T        #
 115 T        #
 116 T        #
 117 C        #
 118 C        #
 119 C        #
 120 A        #
 121 G        #
 122 T        #
 123 C        #
 124 A        #
 125 C        #
 126 G        #
 127 A        #
 128 C        #
 129 G        #
 130 T        #
 131 T        #
 132 G        #
 133 T        #
 134 A        #
 135 A        #
 136 A        #
 137 A        ##
 138 C        ##
 139 G        ##
 140 A        ##
 141 C        ###
 142 G        ####
 143 G        #####
 144 C        ######
 145 C        ######
 146 A        #######
 147 G        ###########
 148 T        ##############
 149 G        ####################
 150 A        #########################
 151 A        #############################################
 152 T        ################################################################
 153 T        ########################################################################
 154 G        #######################################################################################
 155 T        ###################################################################################################
 156 A        ###############################################################################################
 157 A        #######################################################################################
 158 T        #####################################################################################
 159 A        ##########################################################################
 160 C        #############################################################
 161 G        ########################################
 162 A        #######################
 163 C        ####################
 164 T        ##############
 165 C        ###########
 166 A        #######
 167 C        ######
 168 T        ####
 169 A        ###
 170 T        ###
 171 A        ##
 172 G        ##
 173 G        ##
 174 G        ##
 175 C        ##
 176 G        ##
 177 A        #
 178 A        #
 179 T        #
 180 T        #
 181 G        #
 182 G        #
 183 G        #
 184 C        #
 185 C        #
 186 C        #
 187 G        #
 188 A        #
 189 C        #
 190 G        #
 191 T        #
 192 C        #
 193 G        ##
 194 C        #
 195 A        ##
 196 T        ###
 197 G        #####
 198 C        ######
 199 T        ########
 200 C        ##########
 201 C        ##########
 202 T        ############
 203 C        ##########
 204 T        #######
 205 A        #####
 206 G        ####
 207 A        ###
 208 C        ##
 209 T        ##
 210 C        ##
 211 G        ##
 212 A        #
 213 G        #
 214 G        #
 215 A        #
 216 A        #
 217 T        #
 218 T        #
 219 C        #
 220 G        #
 221 G        #
 222 T        #
 223 A        #
 224 C        #
 225 T        #
 226 T        #
 227 T        #
 228 T        #
 229 A        #
 230 A        #
 231 A        
 232 A        
 233 G        
 234 A        
 235 C        
 236 T        
 237 C        
 238 G        
 239 C        
 240 G        
 241 A        
 242 T        
 243 A        
 244 A        


Length from 3'-end
 217 G        ###########
 216 C        ###
 215 G        ####
 214 G        ##
 213 G        ##
 212 C        #
 211 C        #
 210 T        #
 209 C        #
 208 T        #
 207 T        
 206 C        
 205 G        
 204 C        #
 203 T        #
 202 A        
 201 T        
 200 T        
 199 A        #
 198 C        
 197 G        
 196 C        
 195 C        
 194 A        #
 193 G        
 192 C        
 191 T        #
 190 G        #
 189 G        #
 188 C        #
 187 G        
 186 A        #
 185 A        #
 184 A        #
 183 G        #
 182 G        
 181 G        #
 180 G        #
 179 G        
 178 A        #
 177 T        #
 176 G        #
 175 T        #
 174 G        #
 173 C        #
 172 T        #
 171 G        #
 170 C        #
 169 A        #
 168 A        #
 167 G        #
 166 G        #
 165 C        #
 164 G        #
 163 A        #
 162 T        #
 161 T        #
 160 A        #
 159 A        #
 158 G        #
 157 T        #
 156 T        #
 155 G        #
 154 G        #
 153 G        #
 152 T        #
 151 A        #
 150 A        #
 149 C        ###
 148 G        ##
 147 C        ##
 146 C        #
 145 A        #
 144 G        #
 143 G        #
 142 G        #
 141 T        #
 140 T        #
 139 T        #
 138 T        #
 137 C        #
 136 C        #
 135 C        #
 134 A        #
 133 G        #
 132 T        #
 131 C        #
 130 A        #
 129 C        #
 128 G        #
 127 A        #
 126 C        #
 125 G        #
 124 T        #
 123 T        #
 122 G        #
 121 T        #
 120 A        #
 119 A        #
 118 A        #
 117 A        ##
 116 C        ##
 115 G        ##
 114 A        ##
 113 C        ###
 112 G        ####
 111 G        #####
 110 C        ######
 109 C        ######
 108 A        #######
 107 G        ###########
 106 T        ##############
 105 G        ####################
 104 A        #########################
 103 A        #############################################
 102 T        ################################################################
 101 T        ########################################################################
 100 G        #######################################################################################
 99 T         ###################################################################################################
 98 A         ###############################################################################################
 97 A         #######################################################################################
 96 T         #####################################################################################
 95 A         ##########################################################################
 94 C         #############################################################
 93 G         ########################################
 92 A         #######################
 91 C         ####################
 90 T         ##############
 89 C         ###########
 88 A         #######
 87 C         ######
 86 T         ####
 85 A         ###
 84 T         ###
 83 A         ##
 82 G         ##
 81 G         ##
 80 G         ##
 79 C         ##
 78 G         ##
 77 A         #
 76 A         #
 75 T         #
 74 T         #
 73 G         #
 72 G         #
 71 G         #
 70 C         #
 69 C         #
 68 C         #
 67 G         #
 66 A         #
 65 C         #
 64 G         #
 63 T         #
 62 C         #
 61 G         ##
 60 C         #
 59 A         ##
 58 T         ###
 57 G         #####
 56 C         ######
 55 T         ########
 54 C         ##########
 53 C         ##########
 52 T         ############
 51 C         ##########
 50 T         #######
 49 A         #####
 48 G         ####
 47 A         ###
 46 C         ##
 45 T         ##
 44 C         ##
 43 G         ##
 42 A         #
 41 G         #
 40 G         #
 39 A         #
 38 A         #
 37 T         #
 36 T         #
 35 C         #
 34 G         #
 33 G         #
 32 T         #
 31 A         #
 30 C         #
 29 T         #
 28 T         #
 27 T         #
 26 T         #
 25 A         #
 24 A         #
 23 A         
 22 A         
 21 G         
 20 A         
 19 C         
 18 T         
 17 C         
 16 G         
 15 C         
 14 G         
 13 A         
 12 T         
 11 A         
 10 A         


Length from nick
-120 G        ###########
-119 C        ###
-118 G        ####
-117 G        ##
-116 G        ##
-115 C        #
-114 C        #
-113 T        #
-112 C        #
-111 T        #
-110 T        
-109 C        
-108 G        
-107 C        #
-106 T        #
-105 A        
-104 T        
-103 T        
-102 A        #
-101 C        
-100 G        
-99 C         
-98 C         
-97 A         #
-96 G         
-95 C         
-94 T         #
-93 G         #
-92 G         #
-91 C         #
-90 G         
-89 A         #
-88 A         #
-87 A         #
-86 G         #
-85 G         
-84 G         #
-83 G         #
-82 G         
-81 A         #
-80 T         #
-79 G         #
-78 T         #
-77 G         #
-76 C         #
-75 T         #
-74 G         #
-73 C         #
-72 A         #
-71 A         #
-70 G         #
-69 G         #
-68 C         #
-67 G         #
-66 A         #
-65 T         #
-64 T         #
-63 A         #
-62 A         #
-61 G         #
-60 T         #
-59 T         #
-58 G         #
-57 G         #
-56 G         #
-55 T         #
-54 A         #
-53 A         #
-52 C         ###
-51 G         ##
-50 C         ##
-49 C         #
-48 A         #
-47 G         #
-46 G         #
-45 G         #
-44 T         #
-43 T         #
-42 T         #
-41 T         #
-40 C         #
-39 C         #
-38 C         #
-37 A         #
-36 G         #
-35 T         #
-34 C         #
-33 A         #
-32 C         #
-31 G         #
-30 A         #
-29 C         #
-28 G         #
-27 T         #
-26 T         #
-25 G         #
-24 T         #
-23 A         #
-22 A         #
-21 A         #
-20 A         ##
-19 C         ##
-18 G         ##
-17 A         ##
-16 C         ###
-15 G         ####
-14 G         #####
-13 C         ######
-12 C         ######
-11 A         #######
-10 G         ###########
-9 T          ##############
-8 G          ####################
-7 A          #########################
-6 A          #############################################
-5 T          ################################################################
-4 T          ########################################################################
-3 G          #######################################################################################
-2 T          ###################################################################################################
-1 A          ###############################################################################################
 1 A          #######################################################################################
 2 T          #####################################################################################
 3 A          ##########################################################################
 4 C          #############################################################
 5 G          ########################################
 6 A          #######################
 7 C          ####################
 8 T          ##############
 9 C          ###########
 10 A         #######
 11 C         ######
 12 T         ####
 13 A         ###
 14 T         ###
 15 A         ##
 16 G         ##
 17 G         ##
 18 G         ##
 19 C         ##
 20 G         ##
 21 A         #
 22 A         #
 23 T         #
 24 T         #
 25 G         #
 26 G         #
 27 G         #
 28 C         #
 29 C         #
 30 C         #
 31 G         #
 32 A         #
 33 C         #
 34 G         #
 35 T         #
 36 C         #
 37 G         ##
 38 C         #
 39 A         ##
 40 T         ###
 41 G         #####
 42 C         ######
 43 T         ########
 44 C         ##########
 45 C         ##########
 46 T         ############
 47 C         ##########
 48 T         #######
 49 A         #####
 50 G         ####
 51 A         ###
 52 C         ##
 53 T         ##
 54 C         ##
 55 G         ##
 56 A         #
 57 G         #
 58 G         #
 59 A         #
 60 A         #
 61 T         #
 62 T         #
 63 C         #
 64 G         #
 65 G         #
 66 T         #
 67 A         #
 68 C         #
 69 T         #
 70 T         #
 71 T         #
 72 T         #
 73 A         #
 74 A         #
 75 A         
 76 A         
 77 G         
 78 A         
 79 C         
 80 T         
 81 C         
 82 G         
 83 C         
 84 G         
 85 A         
 86 T         
 87 A         
 88 A         


Name of gel and number of scan = No67-1681 def.179
Name of sequence = Clon No 1681
Number of lanes =  4 
Lane for analysis =  3 
Number of analysing nucleotide =  208 
First analysing nucleotide =  37 
3'-nucleotide before nik =  201 
5'-ATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTGTAATACGACTCACTATAGGGCGAATTGGGCCCGACGTCGCATGCTCCTCTAGACTCGAGGAATTCGGTACTTTTAAAAGACTCGCGATAAGCTTGGATC0
Length of fragment =  253   P(K)=P(K)/100

 37 G 5919 
 38 C 1871 
 39 G 2233 
 40 G 1611 
 41 G 1291 
 42 C 1122 
 43 C 1019 
 44 T 847 
 45 C 909 
 46 T 745 
 47 T 655 
 48 C 659 
 49 G 587 
 50 C 741 
 51 T 705 
 52 A 662 
 53 T 662 
 54 T 556 
 55 A 700 
 56 C 575 
 57 G 596 
 58 C 666 
 59 C 663 
 60 A 727 
 61 G 626 
 62 C 634 
 63 T 723 
 64 G 770 
 65 G 867 
 66 C 685 
 67 G 607 
 68 A 676 
 69 A 681 
 70 A 753 
 71 G 690 
 72 G 623 
 73 G 692 
 74 G 765 
 75 G 637 
 76 A 717 
 77 T 801 
 78 G 705 
 79 T 675 
 80 G 766 
 81 C 733 
 82 T 808 
 83 G 869 
 84 C 898 
 85 A 914 
 86 A 908 
 87 G 917 
 88 G 824 
 89 C 793 
 90 G 802 
 91 A 773 
 92 T 823 
 93 T 776 
 94 A 896 
 95 A 935 
 96 G 865 
 97 T 810 
 98 T 826 
 99 G 923 
 100 G 989 
 101 G 965 
 102 T 1064 
 103 A 991 
 104 A 983 
 105 C 1652 
 106 G 1350 
 107 C 1155 
 108 C 1095 
 109 A 1143 
 110 G 981 
 111 G 1061 
 112 G 983 
 113 T 982 
 114 T 947 
 115 T 853 
 116 T 891 
 117 C 910 
 118 C 942 
 119 C 962 
 120 A 953 
 121 G 943 
 122 T 951 
 123 C 960 
 124 A 993 
 125 C 1090 
 126 G 994 
 127 A 969 
 128 C 989 
 129 G 1017 
 130 T 1009 
 131 T 985 
 132 G 1036 
 133 T 987 
 134 A 1022 
 135 A 1017 
 136 A 1086 
 137 A 1252 
 138 C 1383 
 139 G 1463 
 140 A 1538 
 141 C 1863 
 142 G 2150 
 143 G 2865 
 144 C 3107 
 145 C 3201 
 146 A 3880 
 147 G 5975 
 148 T 7344 
 149 G 10157 
 150 A 12723 
 151 A 22334 
 152 T 31493 
 153 T 35432 
 154 G 42707 
 155 T 48664 
 156 A 46562 
 157 A 42675 
 158 T 41690 
 159 A 36591 
 160 C 30123 
 161 G 19832 
 162 A 11835 
 163 C 10244 
 164 T 7426 
 165 C 5584 
 166 A 3768 
 167 C 3105 
 168 T 2454 
 169 A 1833 
 170 T 1709 
 171 A 1505 
 172 G 1525 
 173 G 1513 
 174 G 1427 
 175 C 1218 
 176 G 1299 
 177 A 1142 
 178 A 1110 
 179 T 1078 
 180 T 1094 
 181 G 1151 
 182 G 1066 
 183 G 1060 
 184 C 880 
 185 C 857 
 186 C 1042 
 187 G 1018 
 188 A 926 
 189 C 924 
 190 G 1021 
 191 T 1030 
 192 C 934 
 193 G 1165 
 194 C 1143 
 195 A 1292 
 196 T 1654 
 197 G 2672 
 198 C 3278 
 199 T 4102 
 200 C 5486 
 201 C 5362 
 202 T 6274 
 203 C 5307 
 204 T 3881 
 205 A 2831 
 206 G 2381 
 207 A 1903 
 208 C 1574 
 209 T 1416 
 210 C 1346 
 211 G 1268 
 212 A 1100 
 213 G 1112 
 214 G 1001 
 215 A 984 
 216 A 892 
 217 T 808 
 218 T 789 
 219 C 804 
 220 G 891 
 221 G 795 
 222 T 785 
 223 A 807 
 224 C 770 
 225 T 858 
 226 T 796 
 227 T 1001 
 228 T 805 
 229 A 828 
 230 A 698 
 231 A 628 
 232 A 600 
 233 G 615 
 234 A 484 
 235 C 416 
 236 T 424 
 237 C 359 
 238 G 359 
 239 C 249 
 240 G 451 
 241 A 245 
 242 T 234 
 243 A 206 
 244 A 181 

MAX = 48664   MIN = 181 

Length from 5'-end
 37 G         ###########
 38 C         ###
 39 G         ####
 40 G         ##
 41 G         ##
 42 C         #
 43 C         #
 44 T         #
 45 C         #
 46 T         #
 47 T         
 48 C         
 49 G         
 50 C         #
 51 T         #
 52 A         
 53 T         
 54 T         
 55 A         #
 56 C         
 57 G         
 58 C         
 59 C         
 60 A         #
 61 G         
 62 C         
 63 T         #
 64 G         #
 65 G         #
 66 C         #
 67 G         
 68 A         #
 69 A         #
 70 A         #
 71 G         #
 72 G         
 73 G         #
 74 G         #
 75 G         
 76 A         #
 77 T         #
 78 G         #
 79 T         #
 80 G         #
 81 C         #
 82 T         #
 83 G         #
 84 C         #
 85 A         #
 86 A         #
 87 G         #
 88 G         #
 89 C         #
 90 G         #
 91 A         #
 92 T         #
 93 T         #
 94 A         #
 95 A         #
 96 G         #
 97 T         #
 98 T         #
 99 G         #
 100 G        #
 101 G        #
 102 T        #
 103 A        #
 104 A        #
 105 C        ###
 106 G        ##
 107 C        ##
 108 C        #
 109 A        #
 110 G        #
 111 G        #
 112 G        #
 113 T        #
 114 T        #
 115 T        #
 116 T        #
 117 C        #
 118 C        #
 119 C        #
 120 A        #
 121 G        #
 122 T        #
 123 C        #
 124 A        #
 125 C        #
 126 G        #
 127 A        #
 128 C        #
 129 G        #
 130 T        #
 131 T        #
 132 G        #
 133 T        #
 134 A        #
 135 A        #
 136 A        #
 137 A        ##
 138 C        ##
 139 G        ##
 140 A        ##
 141 C        ###
 142 G        ####
 143 G        #####
 144 C        ######
 145 C        ######
 146 A        #######
 147 G        ###########
 148 T        ##############
 149 G        ####################
 150 A        #########################
 151 A        #############################################
 152 T        ################################################################
 153 T        ########################################################################
 154 G        #######################################################################################
 155 T        ###################################################################################################
 156 A        ###############################################################################################
 157 A        #######################################################################################
 158 T        #####################################################################################
 159 A        ##########################################################################
 160 C        #############################################################
 161 G        ########################################
 162 A        #######################
 163 C        ####################
 164 T        ##############
 165 C        ###########
 166 A        #######
 167 C        ######
 168 T        ####
 169 A        ###
 170 T        ###
 171 A        ##
 172 G        ##
 173 G        ##
 174 G        ##
 175 C        ##
 176 G        ##
 177 A        #
 178 A        #
 179 T        #
 180 T        #
 181 G        #
 182 G        #
 183 G        #
 184 C        #
 185 C        #
 186 C        #
 187 G        #
 188 A        #
 189 C        #
 190 G        #
 191 T        #
 192 C        #
 193 G        ##
 194 C        #
 195 A        ##
 196 T        ###
 197 G        #####
 198 C        ######
 199 T        ########
 200 C        ##########
 201 C        ##########
 202 T        ############
 203 C        ##########
 204 T        #######
 205 A        #####
 206 G        ####
 207 A        ###
 208 C        ##
 209 T        ##
 210 C        ##
 211 G        ##
 212 A        #
 213 G        #
 214 G        #
 215 A        #
 216 A        #
 217 T        #
 218 T        #
 219 C        #
 220 G        #
 221 G        #
 222 T        #
 223 A        #
 224 C        #
 225 T        #
 226 T        #
 227 T        #
 228 T        #
 229 A        #
 230 A        #
 231 A        
 232 A        
 233 G        
 234 A        
 235 C        
 236 T        
 237 C        
 238 G        
 239 C        
 240 G        
 241 A        
 242 T        
 243 A        
 244 A        


Length from 3'-end
 217 G        ###########
 216 C        ###
 215 G        ####
 214 G        ##
 213 G        ##
 212 C        #
 211 C        #
 210 T        #
 209 C        #
 208 T        #
 207 T        
 206 C        
 205 G        
 204 C        #
 203 T        #
 202 A        
 201 T        
 200 T        
 199 A        #
 198 C        
 197 G        
 196 C        
 195 C        
 194 A        #
 193 G        
 192 C        
 191 T        #
 190 G        #
 189 G        #
 188 C        #
 187 G        
 186 A        #
 185 A        #
 184 A        #
 183 G        #
 182 G        
 181 G        #
 180 G        #
 179 G        
 178 A        #
 177 T        #
 176 G        #
 175 T        #
 174 G        #
 173 C        #
 172 T        #
 171 G        #
 170 C        #
 169 A        #
 168 A        #
 167 G        #
 166 G        #
 165 C        #
 164 G        #
 163 A        #
 162 T        #
 161 T        #
 160 A        #
 159 A        #
 158 G        #
 157 T        #
 156 T        #
 155 G        #
 154 G        #
 153 G        #
 152 T        #
 151 A        #
 150 A        #
 149 C        ###
 148 G        ##
 147 C        ##
 146 C        #
 145 A        #
 144 G        #
 143 G        #
 142 G        #
 141 T        #
 140 T        #
 139 T        #
 138 T        #
 137 C        #
 136 C        #
 135 C        #
 134 A        #
 133 G        #
 132 T        #
 131 C        #
 130 A        #
 129 C        #
 128 G        #
 127 A        #
 126 C        #
 125 G        #
 124 T        #
 123 T        #
 122 G        #
 121 T        #
 120 A        #
 119 A        #
 118 A        #
 117 A        ##
 116 C        ##
 115 G        ##
 114 A        ##
 113 C        ###
 112 G        ####
 111 G        #####
 110 C        ######
 109 C        ######
 108 A        #######
 107 G        ###########
 106 T        ##############
 105 G        ####################
 104 A        #########################
 103 A        #############################################
 102 T        ################################################################
 101 T        ########################################################################
 100 G        #######################################################################################
 99 T         ###################################################################################################
 98 A         ###############################################################################################
 97 A         #######################################################################################
 96 T         #####################################################################################
 95 A         ##########################################################################
 94 C         #############################################################
 93 G         ########################################
 92 A         #######################
 91 C         ####################
 90 T         ##############
 89 C         ###########
 88 A         #######
 87 C         ######
 86 T         ####
 85 A         ###
 84 T         ###
 83 A         ##
 82 G         ##
 81 G         ##
 80 G         ##
 79 C         ##
 78 G         ##
 77 A         #
 76 A         #
 75 T         #
 74 T         #
 73 G         #
 72 G         #
 71 G         #
 70 C         #
 69 C         #
 68 C         #
 67 G         #
 66 A         #
 65 C         #
 64 G         #
 63 T         #
 62 C         #
 61 G         ##
 60 C         #
 59 A         ##
 58 T         ###
 57 G         #####
 56 C         ######
 55 T         ########
 54 C         ##########
 53 C         ##########
 52 T         ############
 51 C         ##########
 50 T         #######
 49 A         #####
 48 G         ####
 47 A         ###
 46 C         ##
 45 T         ##
 44 C         ##
 43 G         ##
 42 A         #
 41 G         #
 40 G         #
 39 A         #
 38 A         #
 37 T         #
 36 T         #
 35 C         #
 34 G         #
 33 G         #
 32 T         #
 31 A         #
 30 C         #
 29 T         #
 28 T         #
 27 T         #
 26 T         #
 25 A         #
 24 A         #
 23 A         
 22 A         
 21 G         
 20 A         
 19 C         
 18 T         
 17 C         
 16 G         
 15 C         
 14 G         
 13 A         
 12 T         
 11 A         
 10 A         


Length from nick
-165 G        ###########
-164 C        ###
-163 G        ####
-162 G        ##
-161 G        ##
-160 C        #
-159 C        #
-158 T        #
-157 C        #
-156 T        #
-155 T        
-154 C        
-153 G        
-152 C        #
-151 T        #
-150 A        
-149 T        
-148 T        
-147 A        #
-146 C        
-145 G        
-144 C        
-143 C        
-142 A        #
-141 G        
-140 C        
-139 T        #
-138 G        #
-137 G        #
-136 C        #
-135 G        
-134 A        #
-133 A        #
-132 A        #
-131 G        #
-130 G        
-129 G        #
-128 G        #
-127 G        
-126 A        #
-125 T        #
-124 G        #
-123 T        #
-122 G        #
-121 C        #
-120 T        #
-119 G        #
-118 C        #
-117 A        #
-116 A        #
-115 G        #
-114 G        #
-113 C        #
-112 G        #
-111 A        #
-110 T        #
-109 T        #
-108 A        #
-107 A        #
-106 G        #
-105 T        #
-104 T        #
-103 G        #
-102 G        #
-101 G        #
-100 T        #
-99 A         #
-98 A         #
-97 C         ###
-96 G         ##
-95 C         ##
-94 C         #
-93 A         #
-92 G         #
-91 G         #
-90 G         #
-89 T         #
-88 T         #
-87 T         #
-86 T         #
-85 C         #
-84 C         #
-83 C         #
-82 A         #
-81 G         #
-80 T         #
-79 C         #
-78 A         #
-77 C         #
-76 G         #
-75 A         #
-74 C         #
-73 G         #
-72 T         #
-71 T         #
-70 G         #
-69 T         #
-68 A         #
-67 A         #
-66 A         #
-65 A         ##
-64 C         ##
-63 G         ##
-62 A         ##
-61 C         ###
-60 G         ####
-59 G         #####
-58 C         ######
-57 C         ######
-56 A         #######
-55 G         ###########
-54 T         ##############
-53 G         ####################
-52 A         #########################
-51 A         #############################################
-50 T         ################################################################
-49 T         ########################################################################
-48 G         #######################################################################################
-47 T         ###################################################################################################
-46 A         ###############################################################################################
-45 A         #######################################################################################
-44 T         #####################################################################################
-43 A         ##########################################################################
-42 C         #############################################################
-41 G         ########################################
-40 A         #######################
-39 C         ####################
-38 T         ##############
-37 C         ###########
-36 A         #######
-35 C         ######
-34 T         ####
-33 A         ###
-32 T         ###
-31 A         ##
-30 G         ##
-29 G         ##
-28 G         ##
-27 C         ##
-26 G         ##
-25 A         #
-24 A         #
-23 T         #
-22 T         #
-21 G         #
-20 G         #
-19 G         #
-18 C         #
-17 C         #
-16 C         #
-15 G         #
-14 A         #
-13 C         #
-12 G         #
-11 T         #
-10 C         #
-9 G          ##
-8 C          #
-7 A          ##
-6 T          ###
-5 G          #####
-4 C          ######
-3 T          ########
-2 C          ##########
-1 C          ##########
 1 T          ############
 2 C          ##########
 3 T          #######
 4 A          #####
 5 G          ####
 6 A          ###
 7 C          ##
 8 T          ##
 9 C          ##
 10 G         ##
 11 A         #
 12 G         #
 13 G         #
 14 A         #
 15 A         #
 16 T         #
 17 T         #
 18 C         #
 19 G         #
 20 G         #
 21 T         #
 22 A         #
 23 C         #
 24 T         #
 25 T         #
 26 T         #
 27 T         #
 28 A         #
 29 A         #
 30 A         
 31 A         
 32 G         
 33 A         
 34 C         
 35 T         
 36 C         
 37 G         
 38 C         
 39 G         
 40 A         
 41 T         
 42 A         
 43 A         


Name of gel and number of scan = No193 def.193
Name of sequence = Clon No 1717
Number of lanes =  10 
Lane for analysis =  7 
Number of analysing nucleotide =  201 
First analysing nucleotide =  12 
3'-nucleotide before nik =  131 
5'-TCGAGGAATTCGGTACCCCAATTCGAGCTCGGTACCGGGGCCGCCGGGTAAAAGAAGTGAGAACGCGAAGCGTTCGCACTTCGTCCCAATATATATATATTATTAGGGCGAAGTGCGAGCGCTGGCGCCGTGCCCGACTCCGCGCCGGCCCCGGGGGCGGGCCCGGGCGGCGGGGGGCGGGTCTCTCCGGCGCACATAAAGGCCTGCAGGCATGCAAGCTTGGATC0
Length of fragment =  226   P(K)=P(K)/100

 12 G 1459 
 13 G 183 
 14 T 521 
 15 A 361 
 16 C 294 
 17 C 267 
 18 C 204 
 19 C 212 
 20 A 181 
 21 A 168 
 22 T 171 
 23 T 168 
 24 C 145 
 25 G 129 
 26 A 99 
 27 G 172 
 28 C 138 
 29 T 108 
 30 C 132 
 31 G 109 
 32 G 109 
 33 T 112 
 34 A 81 
 35 C 102 
 36 C 102 
 37 G 109 
 38 G 98 
 39 G 98 
 40 G 80 
 41 C 111 
 42 C 110 
 43 G 107 
 44 C 132 
 45 C 112 
 46 G 100 
 47 G 75 
 48 G 81 
 49 T 100 
 50 A 95 
 51 A 98 
 52 A 71 
 53 A 88 
 54 G 100 
 55 A 97 
 56 A 94 
 57 G 109 
 58 T 91 
 59 G 97 
 60 A 88 
 61 G 122 
 62 A 94 
 63 A 97 
 64 C 82 
 65 G 71 
 66 C 78 
 67 G 92 
 68 A 103 
 69 A 89 
 70 G 109 
 71 C 88 
 72 G 103 
 73 T 96 
 74 T 111 
 75 C 114 
 76 G 92 
 77 C 99 
 78 A 106 
 79 C 119 
 80 T 107 
 81 T 86 
 82 C 108 
 83 G 111 
 84 T 129 
 85 C 114 
 86 C 118 
 87 C 100 
 88 A 112 
 89 A 114 
 90 T 117 
 91 A 256 
 92 T 326 
 93 A 165 
 94 T 252 
 95 A 2132 
 96 T 692 
 97 A 397 
 98 T 71 
 99 A 143 
 100 T 98 
 101 T 123 
 102 A 150 
 103 T 136 
 104 T 130 
 105 A 111 
 106 G 169 
 107 G 128 
 108 G 139 
 109 C 136 
 110 G 133 
 111 A 127 
 112 A 128 
 113 G 123 
 114 T 143 
 115 G 156 
 116 C 146 
 117 G 154 
 118 A 141 
 119 G 188 
 120 C 205 
 121 G 274 
 122 C 329 
 123 T 331 
 124 G 468 
 125 G 872 
 126 C 976 
 127 G 1941 
 128 C 3226 
 129 C 4186 
 130 G 5773 
 131 T 4504 
 132 G 5522 
 133 C 5110 
 134 C 3834 
 135 C 2216 
 136 G 1349 
 137 A 641 
 138 C 654 
 139 T 374 
 140 C 293 
 141 C 234 
 142 G 231 
 143 C 171 
 144 G 167 
 145 C 174 
 146 C 187 
 147 G 120 
 148 G 134 
 149 C 143 
 150 C 126 
 151 C 114 
 152 C 136 
 153 G 120 
 154 G 116 
 155 G 123 
 156 G 136 
 157 G 124 
 158 C 136 
 159 G 137 
 160 G 128 
 161 G 112 
 162 C 127 
 163 C 117 
 164 C 152 
 165 G 140 
 166 G 148 
 167 G 130 
 168 C 158 
 169 G 142 
 170 G 137 
 171 C 127 
 172 G 167 
 173 G 142 
 174 G 150 
 175 G 143 
 176 G 140 
 177 G 136 
 178 C 153 
 179 G 140 
 180 G 136 
 181 G 134 
 182 T 122 
 183 C 133 
 184 T 125 
 185 C 123 
 186 T 129 
 187 C 139 
 188 C 138 
 189 G 132 
 190 G 135 
 191 C 144 
 192 G 123 
 193 C 130 
 194 A 118 
 195 C 126 
 196 A 96 
 197 T 89 
 198 A 110 
 199 A 171 
 200 A 148 
 201 G 117 
 202 G 117 
 203 C 116 
 204 C 102 
 205 T 109 
 206 G 116 
 207 C 124 
 208 A 124 
 209 G 115 
 210 G 109 
 211 C 98 
 212 A 116 

MAX = 5773    MIN = 71 

Length from 5'-end
 12 G         ########################
 13 G         #
 14 T         #######
 15 A         #####
 16 C         ###
 17 C         ###
 18 C         ##
 19 C         ##
 20 A         #
 21 A         #
 22 T         #
 23 T         #
 24 C         #
 25 G         #
 26 A         
 27 G         #
 28 C         #
 29 T         
 30 C         #
 31 G         
 32 G         
 33 T         
 34 A         
 35 C         
 36 C         
 37 G         
 38 G         
 39 G         
 40 G         
 41 C         
 42 C         
 43 G         
 44 C         #
 45 C         
 46 G         
 47 G         
 48 G         
 49 T         
 50 A         
 51 A         
 52 A         
 53 A         
 54 G         
 55 A         
 56 A         
 57 G         
 58 T         
 59 G         
 60 A         
 61 G         
 62 A         
 63 A         
 64 C         
 65 G         
 66 C         
 67 G         
 68 A         
 69 A         
 70 G         
 71 C         
 72 G         
 73 T         
 74 T         
 75 C         
 76 G         
 77 C         
 78 A         
 79 C         
 80 T         
 81 T         
 82 C         
 83 G         
 84 T         #
 85 C         
 86 C         
 87 C         
 88 A         
 89 A         
 90 T         
 91 A         ###
 92 T         ####
 93 A         #
 94 T         ###
 95 A         ###################################
 96 T         ##########
 97 A         #####
 98 T         
 99 A         #
 100 T        
 101 T        
 102 A        #
 103 T        #
 104 T        #
 105 A        
 106 G        #
 107 G        
 108 G        #
 109 C        #
 110 G        #
 111 A        
 112 A        
 113 G        
 114 T        #
 115 G        #
 116 C        #
 117 G        #
 118 A        #
 119 G        ##
 120 C        ##
 121 G        ###
 122 C        ####
 123 T        ####
 124 G        ######
 125 G        #############
 126 C        ###############
 127 G        ################################
 128 C        ######################################################
 129 C        #######################################################################
 130 G        ##################################################################################################
 131 T        ############################################################################
 132 G        ##############################################################################################
 133 C        #######################################################################################
 134 C        #################################################################
 135 C        #####################################
 136 G        ######################
 137 A        #########
 138 C        ##########
 139 T        #####
 140 C        ###
 141 C        ##
 142 G        ##
 143 C        #
 144 G        #
 145 C        #
 146 C        ##
 147 G        
 148 G        #
 149 C        #
 150 C        
 151 C        
 152 C        #
 153 G        
 154 G        
 155 G        
 156 G        #
 157 G        
 158 C        #
 159 G        #
 160 G        
 161 G        
 162 C        
 163 C        
 164 C        #
 165 G        #
 166 G        #
 167 G        #
 168 C        #
 169 G        #
 170 G        #
 171 C        
 172 G        #
 173 G        #
 174 G        #
 175 G        #
 176 G        #
 177 G        #
 178 C        #
 179 G        #
 180 G        #
 181 G        #
 182 T        
 183 C        #
 184 T        
 185 C        
 186 T        #
 187 C        #
 188 C        #
 189 G        #
 190 G        #
 191 C        #
 192 G        
 193 C        #
 194 A        
 195 C        
 196 A        
 197 T        
 198 A        
 199 A        #
 200 A        #
 201 G        
 202 G        
 203 C        
 204 C        
 205 T        
 206 G        
 207 C        
 208 A        
 209 G        
 210 G        
 211 C        
 212 A        


Length from 3'-end
 215 G        ########################
 214 G        #
 213 T        #######
 212 A        #####
 211 C        ###
 210 C        ###
 209 C        ##
 208 C        ##
 207 A        #
 206 A        #
 205 T        #
 204 T        #
 203 C        #
 202 G        #
 201 A        
 200 G        #
 199 C        #
 198 T        
 197 C        #
 196 G        
 195 G        
 194 T        
 193 A        
 192 C        
 191 C        
 190 G        
 189 G        
 188 G        
 187 G        
 186 C        
 185 C        
 184 G        
 183 C        #
 182 C        
 181 G        
 180 G        
 179 G        
 178 T        
 177 A        
 176 A        
 175 A        
 174 A        
 173 G        
 172 A        
 171 A        
 170 G        
 169 T        
 168 G        
 167 A        
 166 G        
 165 A        
 164 A        
 163 C        
 162 G        
 161 C        
 160 G        
 159 A        
 158 A        
 157 G        
 156 C        
 155 G        
 154 T        
 153 T        
 152 C        
 151 G        
 150 C        
 149 A        
 148 C        
 147 T        
 146 T        
 145 C        
 144 G        
 143 T        #
 142 C        
 141 C        
 140 C        
 139 A        
 138 A        
 137 T        
 136 A        ###
 135 T        ####
 134 A        #
 133 T        ###
 132 A        ###################################
 131 T        ##########
 130 A        #####
 129 T        
 128 A        #
 127 T        
 126 T        
 125 A        #
 124 T        #
 123 T        #
 122 A        
 121 G        #
 120 G        
 119 G        #
 118 C        #
 117 G        #
 116 A        
 115 A        
 114 G        
 113 T        #
 112 G        #
 111 C        #
 110 G        #
 109 A        #
 108 G        ##
 107 C        ##
 106 G        ###
 105 C        ####
 104 T        ####
 103 G        ######
 102 G        #############
 101 C        ###############
 100 G        ################################
 99 C         ######################################################
 98 C         #######################################################################
 97 G         ##################################################################################################
 96 T         ############################################################################
 95 G         ##############################################################################################
 94 C         #######################################################################################
 93 C         #################################################################
 92 C         #####################################
 91 G         ######################
 90 A         #########
 89 C         ##########
 88 T         #####
 87 C         ###
 86 C         ##
 85 G         ##
 84 C         #
 83 G         #
 82 C         #
 81 C         ##
 80 G         
 79 G         #
 78 C         #
 77 C         
 76 C         
 75 C         #
 74 G         
 73 G         
 72 G         
 71 G         #
 70 G         
 69 C         #
 68 G         #
 67 G         
 66 G         
 65 C         
 64 C         
 63 C         #
 62 G         #
 61 G         #
 60 G         #
 59 C         #
 58 G         #
 57 G         #
 56 C         
 55 G         #
 54 G         #
 53 G         #
 52 G         #
 51 G         #
 50 G         #
 49 C         #
 48 G         #
 47 G         #
 46 G         #
 45 T         
 44 C         #
 43 T         
 42 C         
 41 T         #
 40 C         #
 39 C         #
 38 G         #
 37 G         #
 36 C         #
 35 G         
 34 C         #
 33 A         
 32 C         
 31 A         
 30 T         
 29 A         
 28 A         #
 27 A         #
 26 G         
 25 G         
 24 C         
 23 C         
 22 T         
 21 G         
 20 C         
 19 A         
 18 G         
 17 G         
 16 C         
 15 A         


Length from nick
-120 G        ########################
-119 G        #
-118 T        #######
-117 A        #####
-116 C        ###
-115 C        ###
-114 C        ##
-113 C        ##
-112 A        #
-111 A        #
-110 T        #
-109 T        #
-108 C        #
-107 G        #
-106 A        
-105 G        #
-104 C        #
-103 T        
-102 C        #
-101 G        
-100 G        
-99 T         
-98 A         
-97 C         
-96 C         
-95 G         
-94 G         
-93 G         
-92 G         
-91 C         
-90 C         
-89 G         
-88 C         #
-87 C         
-86 G         
-85 G         
-84 G         
-83 T         
-82 A         
-81 A         
-80 A         
-79 A         
-78 G         
-77 A         
-76 A         
-75 G         
-74 T         
-73 G         
-72 A         
-71 G         
-70 A         
-69 A         
-68 C         
-67 G         
-66 C         
-65 G         
-64 A         
-63 A         
-62 G         
-61 C         
-60 G         
-59 T         
-58 T         
-57 C         
-56 G         
-55 C         
-54 A         
-53 C         
-52 T         
-51 T         
-50 C         
-49 G         
-48 T         #
-47 C         
-46 C         
-45 C         
-44 A         
-43 A         
-42 T         
-41 A         ###
-40 T         ####
-39 A         #
-38 T         ###
-37 A         ###################################
-36 T         ##########
-35 A         #####
-34 T         
-33 A         #
-32 T         
-31 T         
-30 A         #
-29 T         #
-28 T         #
-27 A         
-26 G         #
-25 G         
-24 G         #
-23 C         #
-22 G         #
-21 A         
-20 A         
-19 G         
-18 T         #
-17 G         #
-16 C         #
-15 G         #
-14 A         #
-13 G         ##
-12 C         ##
-11 G         ###
-10 C         ####
-9 T          ####
-8 G          ######
-7 G          #############
-6 C          ###############
-5 G          ################################
-4 C          ######################################################
-3 C          #######################################################################
-2 G          ##################################################################################################
-1 T          ############################################################################
 1 G          ##############################################################################################
 2 C          #######################################################################################
 3 C          #################################################################
 4 C          #####################################
 5 G          ######################
 6 A          #########
 7 C          ##########
 8 T          #####
 9 C          ###
 10 C         ##
 11 G         ##
 12 C         #
 13 G         #
 14 C         #
 15 C         ##
 16 G         
 17 G         #
 18 C         #
 19 C         
 20 C         
 21 C         #
 22 G         
 23 G         
 24 G         
 25 G         #
 26 G         
 27 C         #
 28 G         #
 29 G         
 30 G         
 31 C         
 32 C         
 33 C         #
 34 G         #
 35 G         #
 36 G         #
 37 C         #
 38 G         #
 39 G         #
 40 C         
 41 G         #
 42 G         #
 43 G         #
 44 G         #
 45 G         #
 46 G         #
 47 C         #
 48 G         #
 49 G         #
 50 G         #
 51 T         
 52 C         #
 53 T         
 54 C         
 55 T         #
 56 C         #
 57 C         #
 58 G         #
 59 G         #
 60 C         #
 61 G         
 62 C         #
 63 A         
 64 C         
 65 A         
 66 T         
 67 A         
 68 A         #
 69 A         #
 70 G         
 71 G         
 72 C         
 73 C         
 74 T         
 75 G         
 76 C         
 77 A         
 78 G         
 79 G         
 80 C         
 81 A         


Name of gel and number of scan = No193 def.193
Name of sequence = Clon No 1717
Number of lanes =  10 
Lane for analysis =  8 
Number of analysing nucleotide =  201 
First analysing nucleotide =  12 
3'-nucleotide before nik =  131 
5'-TCGAGGAATTCGGTACCCCAATTCGAGCTCGGTACCGGGGCCGCCGGGTAAAAGAAGTGAGAACGCGAAGCGTTCGCACTTCGTCCCAATATATATATATTATTAGGGCGAAGTGCGAGCGCTGGCGCCGTGCCCGACTCCGCGCCGGCCCCGGGGGCGGGCCCGGGCGGCGGGGGGCGGGTCTCTCCGGCGCACATAAAGGCCTGCAGGCATGCAAGCTTGGATC0
Length of fragment =  226   P(K)=P(K)/100

 12 G 1659 
 13 G 204 
 14 T 501 
 15 A 351 
 16 C 303 
 17 C 223 
 18 C 222 
 19 C 170 
 20 A 187 
 21 A 169 
 22 T 165 
 23 T 128 
 24 C 141 
 25 G 120 
 26 A 98 
 27 G 102 
 28 C 122 
 29 T 100 
 30 C 84 
 31 G 116 
 32 G 111 
 33 T 94 
 34 A 77 
 35 C 112 
 36 C 82 
 37 G 96 
 38 G 95 
 39 G 110 
 40 G 97 
 41 C 78 
 42 C 91 
 43 G 105 
 44 C 103 
 45 C 111 
 46 G 99 
 47 G 106 
 48 G 107 
 49 T 84 
 50 A 89 
 51 A 109 
 52 A 84 
 53 A 98 
 54 G 96 
 55 A 81 
 56 A 79 
 57 G 96 
 58 T 101 
 59 G 118 
 60 A 93 
 61 G 91 
 62 A 106 
 63 A 98 
 64 C 93 
 65 G 84 
 66 C 67 
 67 G 94 
 68 A 82 
 69 A 75 
 70 G 89 
 71 C 97 
 72 G 98 
 73 T 112 
 74 T 83 
 75 C 104 
 76 G 107 
 77 C 103 
 78 A 114 
 79 C 106 
 80 T 85 
 81 T 102 
 82 C 125 
 83 G 113 
 84 T 112 
 85 C 111 
 86 C 96 
 87 C 97 
 88 A 123 
 89 A 117 
 90 T 111 
 91 A 159 
 92 T 247 
 93 A 134 
 94 T 327 
 95 A 1832 
 96 T 327 
 97 A 81 
 98 T 82 
 99 A 139 
 100 T 123 
 101 T 109 
 102 A 108 
 103 T 125 
 104 T 134 
 105 A 140 
 106 G 141 
 107 G 125 
 108 G 129 
 109 C 147 
 110 G 120 
 111 A 128 
 112 A 139 
 113 G 131 
 114 T 156 
 115 G 157 
 116 C 170 
 117 G 185 
 118 A 151 
 119 G 191 
 120 C 223 
 121 G 264 
 122 C 338 
 123 T 329 
 124 G 451 
 125 G 780 
 126 C 901 
 127 G 2086 
 128 C 3391 
 129 C 4741 
 130 G 6187 
 131 T 5350 
 132 G 6131 
 133 C 5546 
 134 C 4194 
 135 C 2575 
 136 G 1436 
 137 A 727 
 138 C 696 
 139 T 377 
 140 C 322 
 141 C 292 
 142 G 225 
 143 C 182 
 144 G 201 
 145 C 181 
 146 C 182 
 147 G 137 
 148 G 137 
 149 C 127 
 150 C 124 
 151 C 133 
 152 C 130 
 153 G 132 
 154 G 130 
 155 G 124 
 156 G 112 
 157 G 128 
 158 C 168 
 159 G 141 
 160 G 137 
 161 G 125 
 162 C 142 
 163 C 127 
 164 C 166 
 165 G 140 
 166 G 127 
 167 G 150 
 168 C 174 
 169 G 122 
 170 G 162 
 171 C 162 
 172 G 152 
 173 G 150 
 174 G 143 
 175 G 160 
 176 G 147 
 177 G 145 
 178 C 186 
 179 G 161 
 180 G 146 
 181 G 131 
 182 T 138 
 183 C 143 
 184 T 142 
 185 C 133 
 186 T 141 
 187 C 138 
 188 C 161 
 189 G 142 
 190 G 153 
 191 C 144 
 192 G 122 
 193 C 139 
 194 A 127 
 195 C 114 
 196 A 102 
 197 T 98 
 198 A 133 
 199 A 150 
 200 A 143 
 201 G 107 
 202 G 120 
 203 C 114 
 204 C 111 
 205 T 109 
 206 G 103 
 207 C 116 
 208 A 118 
 209 G 109 
 210 G 103 
 211 C 90 
 212 A 105 

MAX = 6187    MIN = 67 

Length from 5'-end
 12 G         #########################
 13 G         ##
 14 T         #######
 15 A         ####
 16 C         ###
 17 C         ##
 18 C         ##
 19 C         #
 20 A         #
 21 A         #
 22 T         #
 23 T         
 24 C         #
 25 G         
 26 A         
 27 G         
 28 C         
 29 T         
 30 C         
 31 G         
 32 G         
 33 T         
 34 A         
 35 C         
 36 C         
 37 G         
 38 G         
 39 G         
 40 G         
 41 C         
 42 C         
 43 G         
 44 C         
 45 C         
 46 G         
 47 G         
 48 G         
 49 T         
 50 A         
 51 A         
 52 A         
 53 A         
 54 G         
 55 A         
 56 A         
 57 G         
 58 T         
 59 G         
 60 A         
 61 G         
 62 A         
 63 A         
 64 C         
 65 G         
 66 C         
 67 G         
 68 A         
 69 A         
 70 G         
 71 C         
 72 G         
 73 T         
 74 T         
 75 C         
 76 G         
 77 C         
 78 A         
 79 C         
 80 T         
 81 T         
 82 C         
 83 G         
 84 T         
 85 C         
 86 C         
 87 C         
 88 A         
 89 A         
 90 T         
 91 A         #
 92 T         ##
 93 A         #
 94 T         ####
 95 A         ############################
 96 T         ####
 97 A         
 98 T         
 99 A         #
 100 T        
 101 T        
 102 A        
 103 T        
 104 T        #
 105 A        #
 106 G        #
 107 G        
 108 G        #
 109 C        #
 110 G        
 111 A        
 112 A        #
 113 G        #
 114 T        #
 115 G        #
 116 C        #
 117 G        #
 118 A        #
 119 G        ##
 120 C        ##
 121 G        ###
 122 C        ####
 123 T        ####
 124 G        ######
 125 G        ###########
 126 C        #############
 127 G        ################################
 128 C        #####################################################
 129 C        ###########################################################################
 130 G        ##################################################################################################
 131 T        #####################################################################################
 132 G        ##################################################################################################
 133 C        ########################################################################################
 134 C        ##################################################################
 135 C        ########################################
 136 G        ######################
 137 A        ##########
 138 C        ##########
 139 T        #####
 140 C        ####
 141 C        ###
 142 G        ##
 143 C        #
 144 G        ##
 145 C        #
 146 C        #
 147 G        #
 148 G        #
 149 C        
 150 C        
 151 C        #
 152 C        #
 153 G        #
 154 G        #
 155 G        
 156 G        
 157 G        
 158 C        #
 159 G        #
 160 G        #
 161 G        
 162 C        #
 163 C        
 164 C        #
 165 G        #
 166 G        
 167 G        #
 168 C        #
 169 G        
 170 G        #
 171 C        #
 172 G        #
 173 G        #
 174 G        #
 175 G        #
 176 G        #
 177 G        #
 178 C        #
 179 G        #
 180 G        #
 181 G        #
 182 T        #
 183 C        #
 184 T        #
 185 C        #
 186 T        #
 187 C        #
 188 C        #
 189 G        #
 190 G        #
 191 C        #
 192 G        
 193 C        #
 194 A        
 195 C        
 196 A        
 197 T        
 198 A        #
 199 A        #
 200 A        #
 201 G        
 202 G        
 203 C        
 204 C        
 205 T        
 206 G        
 207 C        
 208 A        
 209 G        
 210 G        
 211 C        
 212 A        


Length from 3'-end
 215 G        #########################
 214 G        ##
 213 T        #######
 212 A        ####
 211 C        ###
 210 C        ##
 209 C        ##
 208 C        #
 207 A        #
 206 A        #
 205 T        #
 204 T        
 203 C        #
 202 G        
 201 A        
 200 G        
 199 C        
 198 T        
 197 C        
 196 G        
 195 G        
 194 T        
 193 A        
 192 C        
 191 C        
 190 G        
 189 G        
 188 G        
 187 G        
 186 C        
 185 C        
 184 G        
 183 C        
 182 C        
 181 G        
 180 G        
 179 G        
 178 T        
 177 A        
 176 A        
 175 A        
 174 A        
 173 G        
 172 A        
 171 A        
 170 G        
 169 T        
 168 G        
 167 A        
 166 G        
 165 A        
 164 A        
 163 C        
 162 G        
 161 C        
 160 G        
 159 A        
 158 A        
 157 G        
 156 C        
 155 G        
 154 T        
 153 T        
 152 C        
 151 G        
 150 C        
 149 A        
 148 C        
 147 T        
 146 T        
 145 C        
 144 G        
 143 T        
 142 C        
 141 C        
 140 C        
 139 A        
 138 A        
 137 T        
 136 A        #
 135 T        ##
 134 A        #
 133 T        ####
 132 A        ############################
 131 T        ####
 130 A        
 129 T        
 128 A        #
 127 T        
 126 T        
 125 A        
 124 T        
 123 T        #
 122 A        #
 121 G        #
 120 G        
 119 G        #
 118 C        #
 117 G        
 116 A        
 115 A        #
 114 G        #
 113 T        #
 112 G        #
 111 C        #
 110 G        #
 109 A        #
 108 G        ##
 107 C        ##
 106 G        ###
 105 C        ####
 104 T        ####
 103 G        ######
 102 G        ###########
 101 C        #############
 100 G        ################################
 99 C         #####################################################
 98 C         ###########################################################################
 97 G         ##################################################################################################
 96 T         #####################################################################################
 95 G         ##################################################################################################
 94 C         ########################################################################################
 93 C         ##################################################################
 92 C         ########################################
 91 G         ######################
 90 A         ##########
 89 C         ##########
 88 T         #####
 87 C         ####
 86 C         ###
 85 G         ##
 84 C         #
 83 G         ##
 82 C         #
 81 C         #
 80 G         #
 79 G         #
 78 C         
 77 C         
 76 C         #
 75 C         #
 74 G         #
 73 G         #
 72 G         
 71 G         
 70 G         
 69 C         #
 68 G         #
 67 G         #
 66 G         
 65 C         #
 64 C         
 63 C         #
 62 G         #
 61 G         
 60 G         #
 59 C         #
 58 G         
 57 G         #
 56 C         #
 55 G         #
 54 G         #
 53 G         #
 52 G         #
 51 G         #
 50 G         #
 49 C         #
 48 G         #
 47 G         #
 46 G         #
 45 T         #
 44 C         #
 43 T         #
 42 C         #
 41 T         #
 40 C         #
 39 C         #
 38 G         #
 37 G         #
 36 C         #
 35 G         
 34 C         #
 33 A         
 32 C         
 31 A         
 30 T         
 29 A         #
 28 A         #
 27 A         #
 26 G         
 25 G         
 24 C         
 23 C         
 22 T         
 21 G         
 20 C         
 19 A         
 18 G         
 17 G         
 16 C         
 15 A         


Length from nick
-120 G        #########################
-119 G        ##
-118 T        #######
-117 A        ####
-116 C        ###
-115 C        ##
-114 C        ##
-113 C        #
-112 A        #
-111 A        #
-110 T        #
-109 T        
-108 C        #
-107 G        
-106 A        
-105 G        
-104 C        
-103 T        
-102 C        
-101 G        
-100 G        
-99 T         
-98 A         
-97 C         
-96 C         
-95 G         
-94 G         
-93 G         
-92 G         
-91 C         
-90 C         
-89 G         
-88 C         
-87 C         
-86 G         
-85 G         
-84 G         
-83 T         
-82 A         
-81 A         
-80 A         
-79 A         
-78 G         
-77 A         
-76 A         
-75 G         
-74 T         
-73 G         
-72 A         
-71 G         
-70 A         
-69 A         
-68 C         
-67 G         
-66 C         
-65 G         
-64 A         
-63 A         
-62 G         
-61 C         
-60 G         
-59 T         
-58 T         
-57 C         
-56 G         
-55 C         
-54 A         
-53 C         
-52 T         
-51 T         
-50 C         
-49 G         
-48 T         
-47 C         
-46 C         
-45 C         
-44 A         
-43 A         
-42 T         
-41 A         #
-40 T         ##
-39 A         #
-38 T         ####
-37 A         ############################
-36 T         ####
-35 A         
-34 T         
-33 A         #
-32 T         
-31 T         
-30 A         
-29 T         
-28 T         #
-27 A         #
-26 G         #
-25 G         
-24 G         #
-23 C         #
-22 G         
-21 A         
-20 A         #
-19 G         #
-18 T         #
-17 G         #
-16 C         #
-15 G         #
-14 A         #
-13 G         ##
-12 C         ##
-11 G         ###
-10 C         ####
-9 T          ####
-8 G          ######
-7 G          ###########
-6 C          #############
-5 G          ################################
-4 C          #####################################################
-3 C          ###########################################################################
-2 G          ##################################################################################################
-1 T          #####################################################################################
 1 G          ##################################################################################################
 2 C          ########################################################################################
 3 C          ##################################################################
 4 C          ########################################
 5 G          ######################
 6 A          ##########
 7 C          ##########
 8 T          #####
 9 C          ####
 10 C         ###
 11 G         ##
 12 C         #
 13 G         ##
 14 C         #
 15 C         #
 16 G         #
 17 G         #
 18 C         
 19 C         
 20 C         #
 21 C         #
 22 G         #
 23 G         #
 24 G         
 25 G         
 26 G         
 27 C         #
 28 G         #
 29 G         #
 30 G         
 31 C         #
 32 C         
 33 C         #
 34 G         #
 35 G         
 36 G         #
 37 C         #
 38 G         
 39 G         #
 40 C         #
 41 G         #
 42 G         #
 43 G         #
 44 G         #
 45 G         #
 46 G         #
 47 C         #
 48 G         #
 49 G         #
 50 G         #
 51 T         #
 52 C         #
 53 T         #
 54 C         #
 55 T         #
 56 C         #
 57 C         #
 58 G         #
 59 G         #
 60 C         #
 61 G         
 62 C         #
 63 A         
 64 C         
 65 A         
 66 T         
 67 A         #
 68 A         #
 69 A         #
 70 G         
 71 G         
 72 C         
 73 C         
 74 T         
 75 G         
 76 C         
 77 A         
 78 G         
 79 G         
 80 C         
 81 A         


Length from 5'-end
 12 G         #####################################################
 13 G         
 14 T         #################
 15 A         #######
 16 C         ############
 17 C         ########
 18 C         ######
 19 C         ######
 20 A         ######
 21 A         #####
 22 T         ###
 23 T         ####
 24 C         ###
 25 G         ###
 26 A         ###
 27 G         ####
 28 C         ###
 29 T         ###
 30 C         ###
 31 G         ###
 32 G         ##
 33 T         ###
 34 A         ##
 35 C         ###
 36 C         #
 37 G         ##
 38 G         ###
 39 G         ###
 40 G         ###
 41 C         ##
 42 C         ###
 43 G         ###
 44 C         ##
 45 C         ##
 46 G         ###
 47 G         ####
 48 G         ###
 49 T         ##
 50 A         ##
 51 A         ###
 52 A         ###
 53 A         ##
 54 G         ##
 55 A         ###
 56 A         ##
 57 G         ##
 58 T         ##
 59 G         ###
 60 A         ###
 61 G         
 62 A         ##
 63 A         ###
 64 C         ##
 65 G         ###
 66 C         ###
 67 G         ##
 68 A         ##
 69 A         #
 70 G         ##
 71 C         ###
 72 G         ##
 73 T         ##
 74 T         ###
 75 C         ##
 76 G         ##
 77 C         ###
 78 A         ###
 79 C         ##
 80 T         ###
 81 T         ##
 82 C         ##
 83 G         ###
 84 T         ###
 85 C         ###
 86 C         ###
 87 C         ##
 88 A         ####
 89 A         ###
 90 T         ###
 91 A         ####
 92 T         #######
 93 A         #
 94 T         
 95 A         ###################################################################################################
 96 T         #######
 97 A         
 98 T         #
 99 A         ####
 100 T        ###
 101 T        ##
 102 A        ###
 103 T        ####
 104 T        ###
 105 A        ###
 106 G        ####
 107 G        ####
 108 G        ####
 109 C        ###
 110 G        #####
 111 A        ####
 112 A        ####
 113 G        ####
 114 T        ####
 115 G        ####
 116 C        ####
 117 G        #####
 118 A        ####
 119 G        ####
 120 C        #####
 121 G        #######
 122 C        ######
 123 T        #######
 124 G        ########
 125 G        ############
 126 C        ##############
 127 G        ############################
 128 C        ###############################################
 129 C        ##################################################################
 130 G        ##############################################################################
 131 T        ######################################################################################
 132 G        ####################################################################################
 133 C        ###################################################################################
 134 C        ###########################################################
 135 C        #####################################
 136 G        #####################
 137 A        ###########
 138 C        ############
 139 T        ######
 140 C        ######
 141 C        #####
 142 G        ####
 143 C        ###
 144 G        ####
 145 C        ###
 146 C        ####
 147 G        ###
 148 G        ###
 149 C        ###
 150 C        ###
 151 C        ###
 152 C        ####
 153 G        ###
 154 G        ###
 155 G        ###
 156 G        ###
 157 G        ####
 158 C        ####
 159 G        ###
 160 G        ####
 161 G        ####
 162 C        ###
 163 C        ###
 164 C        ####
 165 G        ###
 166 G        ####
 167 G        ####
 168 C        ###
 169 G        ###
 170 G        ####
 171 C        ####
 172 G        ####
 173 G        ####
 174 G        ###
 175 G        ####
 176 G        ####
 177 G        ####
 178 C        ####
 179 G        ####
 180 G        ####
 181 G        ####
 182 T        ###
 183 C        ###
 184 T        ###
 185 C        ##
 186 T        ##
 187 C        ###
 188 C        ###
 189 G        ###
 190 G        ####
 191 C        ####
 192 G        ###
 193 C        ###
 194 A        ##
 195 C        ###
 196 A        ###
 197 T        #
 198 A        ###
 199 A        ####
 200 A        ###
 201 G        ##
 202 G        ###
 203 C        ##
 204 C        ##
 205 T        ##
 206 G        ##
 207 C        ##
 208 A        ###
 209 G        ###
 210 G        ##
 211 C        ##
 212 A        ##


Length from 3'-end
 215 G        #####################################################
 214 G        
 213 T        #################
 212 A        #######
 211 C        ############
 210 C        ########
 209 C        ######
 208 C        ######
 207 A        ######
 206 A        #####
 205 T        ###
 204 T        ####
 203 C        ###
 202 G        ###
 201 A        ###
 200 G        ####
 199 C        ###
 198 T        ###
 197 C        ###
 196 G        ###
 195 G        ##
 194 T        ###
 193 A        ##
 192 C        ###
 191 C        #
 190 G        ##
 189 G        ###
 188 G        ###
 187 G        ###
 186 C        ##
 185 C        ###
 184 G        ###
 183 C        ##
 182 C        ##
 181 G        ###
 180 G        ####
 179 G        ###
 178 T        ##
 177 A        ##
 176 A        ###
 175 A        ###
 174 A        ##
 173 G        ##
 172 A        ###
 171 A        ##
 170 G        ##
 169 T        ##
 168 G        ###
 167 A        ###
 166 G        
 165 A        ##
 164 A        ###
 163 C        ##
 162 G        ###
 161 C        ###
 160 G        ##
 159 A        ##
 158 A        #
 157 G        ##
 156 C        ###
 155 G        ##
 154 T        ##
 153 T        ###
 152 C        ##
 151 G        ##
 150 C        ###
 149 A        ###
 148 C        ##
 147 T        ###
 146 T        ##
 145 C        ##
 144 G        ###
 143 T        ###
 142 C        ###
 141 C        ###
 140 C        ##
 139 A        ####
 138 A        ###
 137 T        ###
 136 A        ####
 135 T        #######
 134 A        #
 133 T        
 132 A        ###################################################################################################
 131 T        #######
 130 A        
 129 T        #
 128 A        ####
 127 T        ###
 126 T        ##
 125 A        ###
 124 T        ####
 123 T        ###
 122 A        ###
 121 G        ####
 120 G        ####
 119 G        ####
 118 C        ###
 117 G        #####
 116 A        ####
 115 A        ####
 114 G        ####
 113 T        ####
 112 G        ####
 111 C        ####
 110 G        #####
 109 A        ####
 108 G        ####
 107 C        #####
 106 G        #######
 105 C        ######
 104 T        #######
 103 G        ########
 102 G        ############
 101 C        ##############
 100 G        ############################
 99 C         ###############################################
 98 C         ##################################################################
 97 G         ##############################################################################
 96 T         ######################################################################################
 95 G         ####################################################################################
 94 C         ###################################################################################
 93 C         ###########################################################
 92 C         #####################################
 91 G         #####################
 90 A         ###########
 89 C         ############
 88 T         ######
 87 C         ######
 86 C         #####
 85 G         ####
 84 C         ###
 83 G         ####
 82 C         ###
 81 C         ####
 80 G         ###
 79 G         ###
 78 C         ###
 77 C         ###
 76 C         ###
 75 C         ####
 74 G         ###
 73 G         ###
 72 G         ###
 71 G         ###
 70 G         ####
 69 C         ####
 68 G         ###
 67 G         ####
 66 G         ####
 65 C         ###
 64 C         ###
 63 C         ####
 62 G         ###
 61 G         ####
 60 G         ####
 59 C         ###
 58 G         ###
 57 G         ####
 56 C         ####
 55 G         ####
 54 G         ####
 53 G         ###
 52 G         ####
 51 G         ####
 50 G         ####
 49 C         ####
 48 G         ####
 47 G         ####
 46 G         ####
 45 T         ###
 44 C         ###
 43 T         ###
 42 C         ##
 41 T         ##
 40 C         ###
 39 C         ###
 38 G         ###
 37 G         ####
 36 C         ####
 35 G         ###
 34 C         ###
 33 A         ##
 32 C         ###
 31 A         ###
 30 T         #
 29 A         ###
 28 A         ####
 27 A         ###
 26 G         ##
 25 G         ###
 24 C         ##
 23 C         ##
 22 T         ##
 21 G         ##
 20 C         ##
 19 A         ###
 18 G         ###
 17 G         ##
 16 C         ##
 15 A         ##


Length from nick
-120 G        #####################################################
-119 G        
-118 T        #################
-117 A        #######
-116 C        ############
-115 C        ########
-114 C        ######
-113 C        ######
-112 A        ######
-111 A        #####
-110 T        ###
-109 T        ####
-108 C        ###
-107 G        ###
-106 A        ###
-105 G        ####
-104 C        ###
-103 T        ###
-102 C        ###
-101 G        ###
-100 G        ##
-99 T         ###
-98 A         ##
-97 C         ###
-96 C         #
-95 G         ##
-94 G         ###
-93 G         ###
-92 G         ###
-91 C         ##
-90 C         ###
-89 G         ###
-88 C         ##
-87 C         ##
-86 G         ###
-85 G         ####
-84 G         ###
-83 T         ##
-82 A         ##
-81 A         ###
-80 A         ###
-79 A         ##
-78 G         ##
-77 A         ###
-76 A         ##
-75 G         ##
-74 T         ##
-73 G         ###
-72 A         ###
-71 G         
-70 A         ##
-69 A         ###
-68 C         ##
-67 G         ###
-66 C         ###
-65 G         ##
-64 A         ##
-63 A         #
-62 G         ##
-61 C         ###
-60 G         ##
-59 T         ##
-58 T         ###
-57 C         ##
-56 G         ##
-55 C         ###
-54 A         ###
-53 C         ##
-52 T         ###
-51 T         ##
-50 C         ##
-49 G         ###
-48 T         ###
-47 C         ###
-46 C         ###
-45 C         ##
-44 A         ####
-43 A         ###
-42 T         ###
-41 A         ####
-40 T         #######
-39 A         #
-38 T         
-37 A         ###################################################################################################
-36 T         #######
-35 A         
-34 T         #
-33 A         ####
-32 T         ###
-31 T         ##
-30 A         ###
-29 T         ####
-28 T         ###
-27 A         ###
-26 G         ####
-25 G         ####
-24 G         ####
-23 C         ###
-22 G         #####
-21 A         ####
-20 A         ####
-19 G         ####
-18 T         ####
-17 G         ####
-16 C         ####
-15 G         #####
-14 A         ####
-13 G         ####
-12 C         #####
-11 G         #######
-10 C         ######
-9 T          #######
-8 G          ########
-7 G          ############
-6 C          ##############
-5 G          ############################
-4 C          ###############################################
-3 C          ##################################################################
-2 G          ##############################################################################
-1 T          ######################################################################################
 1 G          ####################################################################################
 2 C          ###################################################################################
 3 C          ###########################################################
 4 C          #####################################
 5 G          #####################
 6 A          ###########
 7 C          ############
 8 T          ######
 9 C          ######
 10 C         #####
 11 G         ####
 12 C         ###
 13 G         ####
 14 C         ###
 15 C         ####
 16 G         ###
 17 G         ###
 18 C         ###
 19 C         ###
 20 C         ###
 21 C         ####
 22 G         ###
 23 G         ###
 24 G         ###
 25 G         ###
 26 G         ####
 27 C         ####
 28 G         ###
 29 G         ####
 30 G         ####
 31 C         ###
 32 C         ###
 33 C         ####
 34 G         ###
 35 G         ####
 36 G         ####
 37 C         ###
 38 G         ###
 39 G         ####
 40 C         ####
 41 G         ####
 42 G         ####
 43 G         ###
 44 G         ####
 45 G         ####
 46 G         ####
 47 C         ####
 48 G         ####
 49 G         ####
 50 G         ####
 51 T         ###
 52 C         ###
 53 T         ###
 54 C         ##
 55 T         ##
 56 C         ###
 57 C         ###
 58 G         ###
 59 G         ####
 60 C         ####
 61 G         ###
 62 C         ###
 63 A         ##
 64 C         ###
 65 A         ###
 66 T         #
 67 A         ###
 68 A         ####
 69 A         ###
 70 G         ##
 71 G         ###
 72 C         ##
 73 C         ##
 74 T         ##
 75 G         ##
 76 C         ##
 77 A         ###
 78 G         ###
 79 G         ##
 80 C         ##
 81 A         ##


-----------------------------------------------------

Average ultrasonic cleavage profile for all nicks
Number of analysed nicks = 32 
Nik between -1 and +1 nucleotaides

-25            .6 
-24            .5 
-23            .4 
-22            .5 
-21            .5 
-20            .5 
-19            .5 
-18            .5 
-17            .5 
-16            .6 
-15            .6 
-14            .8 
-13            .9 
-12            1 
-11            1.2 
-10            1.3 
-9             1.8 
-8             2 
-7             2.7 
-6             3.3 
-5             4.5 
-4             5.1 
-3             5.8 
-2             6 
-1             5.5 
 1             5.5 
 2             6.5 
 3             5.9 
 4             5.4 
 5             4.5 
 6             3.4 
 7             3 
 8             2.1 
 9             1.9 
 10            1.6 
 11            1.4 
 12            1.3 
 13            1.1 
 14            .9 
 15            .9 
 16            .7 
 17            .7 
 18            .4 
 19            .4 
 20            .4 
 21            .5 
 22            .5 
 23            .4 
 24            .4 
 25            .5 



Number of analysed nicks = 32 
Nik between -1 and +1 nucleotaides

-25           ######
-24           #####
-23           ####
-22           #####
-21           #####
-20           #####
-19           #####
-18           #####
-17           #####
-16           ######
-15           ######
-14           ########
-13           #########
-12           ##########
-11           ############
-10           #############
-9            ##################
-8            ####################
-7            ###########################
-6            #################################
-5            #############################################
-4            ###################################################
-3            ##########################################################
-2            ############################################################
-1            #######################################################
 1            #######################################################
 2            #################################################################
 3            ###########################################################
 4            ######################################################
 5            #############################################
 6            ##################################
 7            ##############################
 8            #####################
 9            ###################
 10           ################
 11           ##############
 12           #############
 13           ###########
 14           #########
 15           #########
 16           #######
 17           #######
 18           ####
 19           ####
 20           ####
 21           #####
 22           #####
 23           ####
 24           ####
 25           #####



(Last update - 23.09.2009)